miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-216b-5p | ||||
| miRNA Stemloop AC | MI0005569 | ||||
| miRNA Stemloop ID | hsa-mir-216b | ||||
| Sequence | aaaucucugcaggcaaauguga | ||||
| TTD Target(s) Regulated by This miRNA | Poly [ADP-ribose] polymerase 1 (PARP1) | Successful Target | Target Info | [1] | |
| Casein kinase II alpha (CSNK2A1) | Clinical trial Target | Target Info | [2] | ||
| Histone deacetylase 8 (HDAC8) | Clinical trial Target | Target Info | [3] | ||
| Transcription factor AP-1 (JUN) | Discontinued Target | Target Info | [4] | ||
| PDZ binding kinase (PBK) | Literature-reported Target | Target Info | [5] | ||
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [6] | ||
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | UDP-glucuronosyltransferase 2B7 | Regulated Protein | [8] | ||
| References | |||||
| REF 1 | MiR-216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. Cancer Gene Ther. 2017 May;24(5):208-214. | ||||
| REF 2 | MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 2012 Dec 14;429(3-4):173-9. | ||||
| REF 3 | MicroRNA-216b is Down-Regulated in Human Gastric Adenocarcinoma and Inhibits Proliferation and Cell Cycle Progression by Targeting Oncogene HDAC8. Target Oncol. 2016 Apr;11(2):197-207. | ||||
| REF 4 | miR-216b regulation of c-Jun mediates GADD153/CHOP-dependent apoptosis. Nat Commun. 2016 May 13;7:11422. | ||||
| REF 5 | miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. Biochem Biophys Res Commun. 2017 Jun 24;488(2):247-252. | ||||
| REF 6 | microRNA-216b inhibits cell proliferation and migration in human melanoma by targeting FOXM1 in vitro and in vivo. Cell Biol Int. 2017 Dec;41(12):1272-1282. | ||||
| REF 7 | MicroRNA-216b/Beclin 1 axis regulates autophagy and apoptosis in human Tenon's capsule fibroblasts upon hydroxycamptothecin exposure. Exp Eye Res. 2014 Jun;123:43-55. | ||||
| REF 8 | Regulation of UGT2B Expression and Activity by miR-216b-5p in Liver Cancer Cell Lines.J Pharmacol Exp Ther. 2016 Oct;359(1):182-93. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.