miRNA General Information
miRNA Mature ID	hsa-miR-218-5p
miRNA Stemloop AC	MI0000294 | MI0000295
miRNA Stemloop ID	hsa-mir-218-1 | hsa-mir-218-2
Sequence	uugugcuugaucuaaccaugu
TTD Target(s) Regulated by This miRNA	Laminin beta-3 chain (LAMB3)	Clinical trial Target	Target Info	[1]
	Transcription factor Sp1 (SP1)	Clinical trial Target	Target Info	[2]
Protein(s) Regulated by This miRNA	28S ribosomal protein S27, mitochondrial	Regulated Protein	RT27_HUMAN	[1]
	Alpha-actinin-1	Regulated Protein	ACTN1_HUMAN	[4]
	B-cell CLL/lymphoma 9 protein	Regulated Protein	BCL9_HUMAN	[5]
	Baculoviral IAP repeat-containing protein 6	Regulated Protein	BIRC6_HUMAN	[4]
	Endophilin-A2	Regulated Protein	SH3G1_HUMAN	[6]
	Endoplasmic reticulum membrane sensor NFE2L1	Regulated Protein	NF2L1_HUMAN	[7]
	Ephrin-A1	Regulated Protein	EFNA1_HUMAN	[1]
	Homeobox protein Hox-B3	Regulated Protein	HXB3_HUMAN	[8]
	Leucine-rich repeat-containing G-protein coupled receptor 4	Regulated Protein	LGR4_HUMAN	[9]
	LIM and SH3 domain protein 1	Regulated Protein	LASP1_HUMAN	[7]
	Lymphoid enhancer-binding factor 1	Regulated Protein	LEF1_HUMAN	[10]
	Microphthalmia-associated transcription factor	Regulated Protein	MITF_HUMAN	[11]
	Nuclear pore complex protein Nup93	Regulated Protein	NUP93_HUMAN	[1]
	OTU domain-containing protein 7B	Regulated Protein	OTU7B_HUMAN	[12]
	POU domain, class 2, transcription factor 2	Regulated Protein	PO2F2_HUMAN	[13]
	Protein Tob1	Regulated Protein	TOB1_HUMAN	[14]
	Roundabout homolog 1	Regulated Protein	ROBO1_HUMAN	[15]
	Secreted frizzled-related protein 2	Regulated Protein	SFRP2_HUMAN	[16]
	Signal transducing adapter molecule 2	Regulated Protein	STAM2_HUMAN	[4]
	Slit homolog 2 protein	Regulated Protein	SLIT2_HUMAN	[17]
	Slit homolog 3 protein	Regulated Protein	SLIT3_HUMAN	[17]
	Transcription factor MafG	Regulated Protein	MAFG_HUMAN	[7]
	Vacuolar protein sorting-associated protein 51 homolog	Regulated Protein	VPS51_HUMAN	[18]
	Vesicular, overexpressed in cancer, prosurvival protein 1	Regulated Protein	VOPP1_HUMAN	[7]
	Wiskott-Aldrich syndrome protein family member 3	Regulated Protein	WASF3_HUMAN	[19]
References
REF 1	Human papillomavirus type 16 reduces the expression of microRNA-218 in cervical carcinoma cells. Oncogene. 2008 Apr 17;27(18):2575-82.
REF 2	The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res. 2007 Nov 15;67(22):11001-11.
REF 3	Human papillomavirus type 16 reduces the expression of microRNA-218 in cervical carcinoma cells. Oncogene. 2008 Apr 17;27(18):2575-82.
REF 4	Reduced microRNA-218 expression is associated with high nuclear factor kappa B activation in gastric cancer.Cancer. 2010 Jan 1;116(1):41-9.
REF 5	Differentially expressed microRNA-218odulates the viability of renal cell carcinoma by regulating BCL9.Mol Med Rep. 2016 Aug;14(2):1829-34.
REF 6	miR-218 is downregulated and directly targets SH3GL1 in childhood medulloblastoma.Mol Med Rep. 2013 Oct;8(4):1111-7.
REF 7	MicroRNAs as modulators of smoking-induced gene expression changes in human airway epithelium.Proc Natl Acad Sci U S A. 2009 Feb 17;106(7):2319-24.
REF 8	miR-7 and miR-218 epigenetically control tumor suppressor genes RASSF1A and Claudin-6 by targeting HoxB3 in breast cancer.Biochem Biophys Res Commun. 2012 Jul 20;424(1):28-33.
REF 9	MiR-218 impedes IL-6-induced prostate cancer cell proliferation and invasion via suppression of LGR4 expression.Oncol Rep. 2016 May;35(5):2859-65.
REF 10	MiR-218 reverses high invasiveness of glioblastoma cells by targeting the oncogenic transcription factor LEF1.Oncol Rep. 2012 Sep;28(3):1013-21.
REF 11	Mir-218 contributes to the transformation of 5-Aza/GF induced umbilical cord mesenchymal stem cells into hematopoietic cells through the MITF pathway.Mol Biol Rep. 2014 Jul;41(7):4803-16.
REF 12	miR-218 regulates focal adhesion kinase-dependent TGF signaling in fibroblasts.Mol Biol Cell. 2014 Apr;25(7):1151-8.
REF 13	POU2F2-oriented network promotes human gastric cancer metastasis.Gut. 2016 Sep;65(9):1427-38.
REF 14	miR-218 directs a Wnt signaling circuit to promote differentiation of osteoblasts and osteomimicry of metastatic cancer cells.J Biol Chem. 2012 Dec 7;287(50):42084-92.
REF 15	MiR-218 suppresses nasopharyngeal cancer progression through downregulation of survivin and the SLIT2-ROBO1 pathway.Cancer Res. 2011 Mar 15;71(6):2381-91.
REF 16	MicroRNAs modulate the Wnt signaling pathway through targeting its inhibitors.Biochem Biophys Res Commun. 2011 May 6;408(2):259-64.
REF 17	Specific expression and methylation of SLIT1, SLIT2, SLIT3, and miR-218 in gastric cancer subtypes.Int J Oncol. 2016 Jun;48(6):2497-507.
REF 18	miR-218 suppresses gastric cancer cell proliferation and invasion via regulation of angiopoietin-2.Exp Ther Med. 2016 Dec;12(6):3837-3842.
REF 19	miR-218 Inhibits Proliferation, Migration, and EMT of Gastric Cancer Cells by Targeting WASF3.Oncol Res. 2017 Mar 13;25(3):355-364.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.