miRNA General Information
miRNA Mature ID	hsa-miR-219a-2-3p
miRNA Stemloop AC	MI0000740
miRNA Stemloop ID	hsa-mir-219a-2
Sequence	agaauuguggcuggacaucugu
TTD Target(s) Regulated by This miRNA	Erbb3 tyrosine kinase receptor (Erbb-3)	Clinical trial Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Ankyrin repeat domain-containing protein 13C	Regulated Protein	AN13C_HUMAN	[1]
	Cancer/testis antigen 62	Regulated Protein	CT62_HUMAN	[1]
	Netrin receptor DCC	Regulated Protein	DCC_HUMAN	[1]
	Neuronal migration protein doublecortin	Regulated Protein	DCX_HUMAN	[1]
References
REF 1	Epigenetically silenced microRNAs in gastric cancer: Functional analysis and identification of their target genes. Oncol Rep. 2015 Aug;34(2):1017-26.
REF 2	Epigenetically silenced microRNAs in gastric cancer: Functional analysis and identification of their target genes. Oncol Rep. 2015 Aug;34(2):1017-26.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.