miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-22-3p
miRNA Stemloop AC MI0000078
miRNA Stemloop ID hsa-mir-22
Sequence aagcugccaguugaagaacugu
TTD Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [1]
Estrogen receptor (ESR) Successful Target Target Info [2]
Monoamine oxidase type A (MAO-A) Successful Target Target Info [3]
Peroxisome proliferator-activated receptor alpha (PPARA) Successful Target Target Info [4]
5-HT 2C receptor (HTR2C) Successful Target Target Info [3]
BDNF/NT-3 growth factors receptor (TrkB) Successful Target Target Info [5]
C-X-C chemokine receptor type 2 (CXCR2) Successful Target Target Info [6]
Histone deacetylase 6 (HDAC6) Clinical trial Target Target Info [7]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [6]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [8]
Matrix metalloproteinase-14 (MMP-14) Clinical trial Target Target Info [9]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [10]
Polo-like kinase 1 (PLK1) Clinical trial Target Target Info [11]
Erbb3 tyrosine kinase receptor (Erbb-3) Clinical trial Target Target Info [12]
Basigin (BSG) Clinical trial Target Target Info [13]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [3]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [14]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [15]
Colony stimulating factor-1 receptor (CSF-1R) Clinical trial Target Target Info [16]
ATP-citrate synthase (ACLY) Successful Target Target Info [17]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [18]
Cyclin A2 (CCNA2) Literature-reported Target Target Info [19]
HepG2 glucose transporter (SLC2A1) Preclinical Target Target Info [20]
High mobility group protein B1 (HMGB1) Literature-reported Target Target Info [21]
Metastasis associated gene-1 (MTA1) Literature-reported Target Target Info [22]
Transferrin receptor protein 1 (TFRC) Clinical trial Target Target Info [23]
Cysteine-rich angiogenic inducer 61 (CYR61) Literature-reported Target Target Info [24]
G0/G1 switch regulatory protein 8 (RGS2) Literature-reported Target Target Info [3]
Galectin-1 (LGALS1) Patented-recorded Target Target Info [14]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [25]
Metastasis adhesion protein (MTDH) Literature-reported Target Target Info [26]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [27]
B-cell translocation gene 1 protein (BTG1) Literature-reported Target Target Info [28]
Protein(s) Regulated by This miRNA Actin-related protein 2/3 complex subunit 5 Regulated Protein
ARPC5_HUMAN
[29]
Activin receptor type-1C Regulated Protein
ACV1C_HUMAN
[30]
Bone morphogenetic protein 6 Regulated Protein
BMP6_HUMAN
[31]
Bone morphogenetic protein 7 Regulated Protein
BMP7_HUMAN
[32]
Bone morphogenetic protein receptor type-1B Regulated Protein
BMR1B_HUMAN
[31]
CD151 antigen Regulated Protein
CD151_HUMAN
[33]
E3 ubiquitin-protein ligase UBR5 Regulated Protein
UBR5_HUMAN
[34]
Galectin-9 Regulated Protein
LEG9_HUMAN
[35]
Interferon regulatory factor 5 Regulated Protein
IRF5_HUMAN
[21]
MDS1 and EVI1 complex locus protein Regulated Protein
MECOM_HUMAN
[37]
Methylcytosine dioxygenase TET2 Regulated Protein
TET2_HUMAN
[38]
Neuroepithelial cell-transforming gene 1 protein Regulated Protein
ARHG8_HUMAN
[39]
Nuclear receptor coactivator 1 Regulated Protein
NCOA1_HUMAN
[40]
Parathymosin Regulated Protein
PTMS_HUMAN
[41]
Protein phosphatase 1K, mitochondrial Regulated Protein
PPM1K_HUMAN
[42]
Proto-oncogene Wnt-1 Regulated Protein
WNT1_HUMAN
[43]
Ras-related protein Rab-5B Regulated Protein
RAB5B_HUMAN
[44]
REST corepressor 1 Regulated Protein
RCOR1_HUMAN
[45]
Transcription elongation factor A protein-like 1 Regulated Protein
TCAL1_HUMAN
[46]
Transcription factor 7 Regulated Protein
TCF7_HUMAN
[47]
Transforming acidic coiled-coil-containing protein 1 Regulated Protein
TACC1_HUMAN
[44]
Zinc finger protein SNAI1 Regulated Protein
SNAI1_HUMAN
[9]
References
REF 1 Dual Action of miR-125b As a Tumor Suppressor and OncomiR-22 Promotes Prostate Cancer Tumorigenesis. PLoS One. 2015 Nov 6;10(11):e0142373.
REF 2 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 3 Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.
REF 4 Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7.
REF 5 NTRK2 is an oncogene and associated with microRNA-22 regulation in human gastric cancer cell lines. Tumour Biol. 2016 Nov;37(11):15115-15123.
REF 6 The lncRNA MALAT1 protects the endothelium against ox-LDL-induced dysfunction via upregulating the expression of the miR-22-3p target genes CXCR2 and AKT. FEBS Lett. 2015 Oct 7;589(20 Pt B):3189-96.
REF 7 MicroRNA-22 Promoted Osteogenic Differentiation of Human Periodontal Ligament Stem Cells by Targeting HDAC6. J Cell Biochem. 2017 Jul;118(7):1653-1658.
REF 8 microRNA-22, downregulated in hepatocellular carcinoma and correlated with prognosis, suppresses cell proliferation and tumourigenicity. Br J Cancer. 2010 Oct 12;103(8):1215-20.
REF 9 MicroRNA-22 inhibits tumor growth and metastasis in gastric cancer by directly targeting MMP14 and Snail. Cell Death Dis. 2015 Nov 26;6:e2000.
REF 10 miR-22 inhibits the proliferation, motility, and invasion of human glioblastoma cells by directly targeting SIRT1. Tumour Biol. 2016 May;37(5):6761-8.
REF 11 Identification of post-transcriptional regulatory networks during myeloblast-to-monocyte differentiation transition. RNA Biol. 2015;12(7):690-700.
REF 12 Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3. J Cancer Res Clin Oncol. 2012 Aug;138(8):1355-61.
REF 13 A regulatory loop involving miR-22, Sp1, and c-Myc modulates CD147 expression in breast cancer invasion and metastasis. Cancer Res. 2014 Jul 15;74(14):3764-78.
REF 14 Galectin-1 has potential prognostic significance and is implicated in clear cell renal cell carcinoma progression through the HIF/mTOR signaling axis. Br J Cancer. 2014 Mar 4;110(5):1250-9.
REF 15 miR-22 represses cancer progression by inducing cellular senescence. J Cell Biol. 2011 Apr 18;193(2):409-24.
REF 16 MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells. Front Immunol. 2013 Oct 30;4:353.
REF 17 miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer. Oncotarget. 2016 Jul 12;7(28):44252-44265.
REF 18 Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010 Apr 13;3(117):ra29.
REF 19 MiR-22-silenced cyclin A expression in colon and liver cancer cells is regulated by bile acid receptor. J Biol Chem. 2015 Mar 6;290(10):6507-15.
REF 20 miR-22 as a prognostic factor targets glucose transporter protein type 1 in breast cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):410-7.
REF 21 A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54.
REF 22 MTA1-activated Epi-microRNA-22 regulates E-cadherin and prostate cancer invasiveness. FEBS Lett. 2017 Mar;591(6):924-933.
REF 23 miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation. Exp Hematol. 2009 Feb;37(2):245-55.
REF 24 A novel p53/microRNA-22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis Rheumatol. 2014 Jan;66(1):49-59.
REF 25 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 26 microRNA-22 acts as a metastasis suppressor by targeting metadherin in gastric cancer. Mol Med Rep. 2015 Jan;11(1):454-60.
REF 27 miRNA-22 suppresses colon cancer cell migration and invasion by inhibiting the expression of T-cell lymphoma invasion and metastasis 1 and matrix metalloproteinases 2 and 9. Oncol Rep. 2013 May;29(5):1932-8.
REF 28 MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett. 2015 Jan 28;356(2 Pt B):781-90.
REF 29 Interaction between microRNAs and actin-associated protein Arpc5 regulates translational suppression during male germ cell differentiation.Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5750-5.
REF 30 MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68.
REF 31 MicroRNA-22 is a master regulator of bone morphogenetic protein-7/6 homeostasis in the kidney.J Biol Chem. 2013 Dec 20;288(51):36202-14.
REF 32 Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS One. 2008;3(11):e3740.
REF 33 MiR-22 suppresses the proliferation and invasion of gastric cancer cells by inhibiting CD151.Biochem Biophys Res Commun. 2014 Feb 28;445(1):175-9.
REF 34 EDD1 predicts prognosis and regulates gastric cancer growth in vitro and in vivo via miR-22. Biol Chem. 2016 Apr 28. pii: /j/bchm.just-accepted/hsz-2015-0279/hsz-2015-0279.xml.
REF 35 microRNA-22 downregulation of galectin-9 influences lymphocyte apoptosis and tumor cell proliferation in liver cancer.Oncol Rep. 2015 Oct;34(4):1771-8.
REF 36 A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54.
REF 37 The PU.1-Modulated MicroRNA-22 Is a Regulator of Monocyte/Macrophage Differentiation and Acute Myeloid Leukemia.PLoS Genet. 2016 Sep 12;12(9):e1006259.
REF 38 MicroRNA-antagonism regulates breast cancer stemness and metastasis via TET-family-dependent chromatin remodeling.Cell. 2013 Jul 18;154(2):311-324.
REF 39 miR-22 regulates expression of oncogenic neuro-epithelial transforming gene 1, NET1.FEBS J. 2014 Sep;281(17):3904-19.
REF 40 MicroRNA-22 and microRNA-140 suppress NF-B activity by regulating the expression of NF-B coactivators.Biochem Biophys Res Commun. 2011 Aug 12;411(4):826-31.
REF 41 MicroRNA-22 can reduce parathymosin expression in transdifferentiated hepatocytes.PLoS One. 2012;7(4):e34116.
REF 42 Regulation of PP2Cm expression by miRNA-204/211 and miRNA-22 in mouse and human cells.Acta Pharmacol Sin. 2015 Dec;36(12):1480-6.
REF 43 Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathway by up-regulation of miR-200b and miR-22.Cancer Lett. 2013 Oct 28;340(1):72-81.
REF 44 Deep Sequencing Reveals a Novel miR-22 Regulatory Network with Therapeutic Potential in Rhabdomyosarcoma.Cancer Res. 2016 Oct 15;76(20):6095-6106.
REF 45 MicroRNA-22 (miR-22) overexpression is neuroprotective via general anti-apoptotic effects and may also target specific Huntington's disease-related mechanisms. PLoS One. 2013;8(1):e54222.
REF 46 Tumor suppressor miR-22 determines p53-dependent cellular fate through post-transcriptional regulation of p21.Cancer Res. 2011 Jul 1;71(13):4628-39.
REF 47 Elevated Hepatic miR-22-3p Expression Impairs Gluconeogenesis by Silencing the Wnt-Responsive Transcription Factor Tcf7.Diabetes. 2015 Nov;64(11):3659-69.
REF 48 MicroRNA-22 inhibits tumor growth and metastasis in gastric cancer by directly targeting MMP14 and Snail. Cell Death Dis. 2015 Nov 26;6:e2000.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.