miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-221-5p | ||||
| miRNA Stemloop AC | MI0000298 | ||||
| miRNA Stemloop ID | hsa-mir-221 | ||||
| Sequence | accuggcauacaauguagauuu | ||||
| TTD Target(s) Regulated by This miRNA | CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [1] | |
| CDK inhibitor 1C p57Kip2 (CDKN1C) | Literature-reported Target | Target Info | [1] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Interleukin-6 receptor subunit alpha | Regulated Protein | [3] | ||
| Methyl-CpG-binding domain protein 2 | Regulated Protein | [4] | |||
| Sjoegren syndrome/scleroderma autoantigen 1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Epstein-Barr Virus Proteins EBNA3A and EBNA3C Together Induce Expression of the Oncogenic MicroRNA Cluster miR-221/miR-222 and Ablate Expression of Its Target p57KIP2. PLoS Pathog. 2015 Jul 8;11(7):e1005031. | ||||
| REF 2 | MicroRNA-221 is involved in the regulation of osteoporosis through regulates RUNX2 protein expression and osteoblast differentiation. Am J Transl Res. 2017 Jan 15;9(1):126-135. | ||||
| REF 3 | Identification of a novel substance P (SP)-neurokinin-1 receptor (NK-1R) microRNA-221-5p inflammatory network in human colonic epithelial cells.Cell Mol Gastroenterol Hepatol. 2015 Sep 1;1(5):503-515. | ||||
| REF 4 | Decreased levels of miR-224 and the passenger strand of miR-221 increase MBD2, suppressing maspin and promoting colorectal tumor growth and metastasis in mice.Gastroenterology. 2013 Oct;145(4):853-64.e9. | ||||
| REF 5 | Metformin Causes G1-Phase Arrest via Down-Regulation of MiR-221 and Enhances TRAIL Sensitivity through DR5 Up-Regulation in Pancreatic Cancer Cells.PLoS One. 2015 May 8;10(5):e0125779. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.