miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-223-5p | ||||
| miRNA Stemloop AC | MI0000300 | ||||
| miRNA Stemloop ID | hsa-mir-223 | ||||
| Sequence | cguguauuugacaagcugaguu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Epidermal growth factor (EGF) | Successful Target | Target Info | [2] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | F-box only protein 8 | Regulated Protein | [4] | ||
| Ras-related protein Rab-12 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Down-regulation of microRNA-223 promotes degranulation via the PI3K/Akt pathway by targeting IGF-1R in mast cells. PLoS One. 2015 Apr 13;10(4):e0123575. | ||||
| REF 2 | Radiotherapy-induced miR-223 prevents relapse of breast cancer by targeting the EGF pathway. Oncogene. 2016 Sep 15;35(37):4914-26. | ||||
| REF 3 | miR-223/FBW7 axis regulates doxorubicin sensitivity through epithelial mesenchymal transition in non-small cell lung cancer. Am J Transl Res. 2016 Jun 15;8(6):2512-24. | ||||
| REF 4 | FBX8 is a metastasis suppressor downstream of miR-223 and targeting mTOR for degradation in colorectal carcinoma.Cancer Lett. 2017 Mar 1;388:85-95. | ||||
| REF 5 | Myeloid Dysregulation in a Human Induced Pluripotent Stem Cell Model of PTPN11-Associated Juvenile Myelomonocytic Leukemia.Cell Rep. 2015 Oct 20;13(3):504-515. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.