miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-224-5p | ||||
| miRNA Stemloop AC | MI0000301 | ||||
| miRNA Stemloop ID | hsa-mir-224 | ||||
| Sequence | ucaagucacuagugguuccguuuag | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Platelet-derived growth factor receptor beta (PDGFRB) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [3] | ||
| C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [4] | ||
| Endothelin A receptor (EDNRA) | Successful Target | Target Info | [5] | ||
| Iodothyronine deiodinase type I (DIO1) | Successful Target | Target Info | [6] | ||
| Dihydropyrimidinase related protein 2 (DPYSL2) | Successful Target | Target Info | [7] | ||
| Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [8] | ||
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [9] | ||
| CD40L receptor (CD40) | Clinical trial Target | Target Info | [10] | ||
| Caspase-7 (CASP7) | Clinical trial Target | Target Info | [9] | ||
| Ras-related C3 botulinum toxin substrate 1 (RAC1) | Literature-reported Target | Target Info | [11] | ||
| PAK-2 protein kinase (PAK2) | Literature-reported Target | Target Info | [3] | ||
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [3] | ||
| APJ endogenous ligand (Apelin) | Literature-reported Target | Target Info | [12] | ||
| Protein(s) Regulated by This miRNA | Alpha-2-antiplasmin | Regulated Protein | [13] | ||
| AP-2 complex subunit mu | Regulated Protein | [14] | |||
| Apoptosis inhibitor 5 | Regulated Protein | [15] | |||
| Cell division control protein 42 homolog | Regulated Protein | [4] | |||
| Deaminated glutathione amidase | Regulated Protein | [14] | |||
| Eyes absent homolog 4 | Regulated Protein | [5] | |||
| Homeobox protein Hox-D10 | Regulated Protein | [18] | |||
| Kallikrein-10 | Regulated Protein | [19] | |||
| Methyl-CpG-binding domain protein 2 | Regulated Protein | [20] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [21] | |||
| Nuclear receptor coactivator 6 | Regulated Protein | [14] | |||
| Pentraxin-related protein PTX3 | Regulated Protein | [22] | |||
| PH domain leucine-rich repeat-containing protein phosphatase 1 | Regulated Protein | [23] | |||
| PH domain leucine-rich repeat-containing protein phosphatase 2 | Regulated Protein | [24] | |||
| Phosphatidylethanolamine-binding protein 1 | Regulated Protein | [25] | |||
| Protein fosB | Regulated Protein | [14] | |||
| Ras association domain-containing protein 8 | Regulated Protein | [26] | |||
| Ras-related protein Rab-9B | Regulated Protein | [2] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [28] | |||
| Tribbles homolog 1 | Regulated Protein | [29] | |||
| Tumor protein D52 | Regulated Protein | [30] | |||
| References | |||||
| REF 1 | MicroRNA-224 aggrevates tumor growth and progression by targeting mTOR in gastric cancer. Int J Oncol. 2016 Sep;49(3):1068-80. | ||||
| REF 2 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
| REF 3 | Involvement of microRNA-224 in cell proliferation, migration, invasion, and anti-apoptosis in hepatocellular carcinoma. J Gastroenterol Hepatol. 2013 Mar;28(3):565-75. | ||||
| REF 4 | Ubc9 promotes breast cell invasion and metastasis in a sumoylation-independent manner. Oncogene. 2010 Mar 25;29(12):1763-72. | ||||
| REF 5 | A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9. | ||||
| REF 6 | MiR-224 targets the 3'UTR of type 1 5'-iodothyronine deiodinase possibly contributing to tissue hypothyroidism in renal cancer. PLoS One. 2011;6(9):e24541. | ||||
| REF 7 | Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589. | ||||
| REF 8 | Circulating microRNA predicts insensitivity to glucocorticoid therapy in Graves' ophthalmopathy. Endocrine. 2015 Jun;49(2):445-56. | ||||
| REF 9 | MicroRNA-224 is implicated in lung cancer pathogenesis through targeting caspase-3 and caspase-7. Oncotarget. 2015 Sep 8;6(26):21802-15. | ||||
| REF 10 | Involvement of CD40 targeting miR-224 and miR-486 on the progression of pancreatic ductal adenocarcinomas. Ann Surg Oncol. 2009 Aug;16(8):2339-50. | ||||
| REF 11 | MicroRNA-224 promotes the sensitivity of osteosarcoma cells to cisplatin by targeting Rac1. J Cell Mol Med. 2016 Sep;20(9):1611-9. | ||||
| REF 12 | Dysregulated microRNA-224/apelin axis associated with aggressive progression and poor prognosis in patients with prostate cancer. Hum Pathol. 2015 Feb;46(2):295-303. | ||||
| REF 13 | MiR-224 expression increases radiation sensitivity of glioblastoma cells.Biochem Biophys Res Commun. 2014 May 30;448(2):225-30. | ||||
| REF 14 | MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9. | ||||
| REF 15 | Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target.J Biol Chem. 2008 May 9;283(19):13205-15. | ||||
| REF 16 | Ubc9 promotes breast cell invasion and metastasis in a sumoylation-independent manner. Oncogene. 2010 Mar 25;29(12):1763-72. | ||||
| REF 17 | A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9. | ||||
| REF 18 | miR-224 promotion of cell migration and invasion by targeting Homeobox D 10 gene in human hepatocellular carcinoma.J Gastroenterol Hepatol. 2014 Apr;29(4):835-42. | ||||
| REF 19 | Three dysregulated miRNAs control kallikrein 10 expression and cell proliferation in ovarian cancer.Br J Cancer. 2010 Apr 13;102(8):1244-53. | ||||
| REF 20 | Decreased levels of miR-224 and the passenger strand of miR-221 increase MBD2, suppressing maspin and promoting colorectal tumor growth and metastasis in mice.Gastroenterology. 2013 Oct;145(4):853-64.e9. | ||||
| REF 21 | MicroRNA-224 is involved in transforming growth factor-beta-mediated mouse granulosa cell proliferation and granulosa cell function by targeting Smad4.Mol Endocrinol. 2010 Mar;24(3):540-51. | ||||
| REF 22 | microRNA-224 regulates Pentraxin 3, a component of the humoral arm of innate immunity, in inner ear inflammation.Hum Mol Genet. 2014 Jun 15;23(12):3138-46. | ||||
| REF 23 | microRNA-224 promotes cell proliferation and tumor growth in human colorectal cancer by repressing PHLPP1 and PHLPP2.Clin Cancer Res. 2013 Sep 1;19(17):4662-72. | ||||
| REF 24 | Expression and role of oncogenic miRNA-224 in esophageal squamous cell carcinoma.BMC Cancer. 2015 Aug 6;15:575. | ||||
| REF 25 | MicroRNA-224 targets RKIP to control cell invasion and expression of metastasis genes in human breast cancer cells.Biochem Biophys Res Commun. 2012 Aug 24;425(2):127-33. | ||||
| REF 26 | Hypoxia-inducible microRNA-224 promotes the cell growth, migration and invasion by directly targeting RASSF8 in gastric cancer.Mol Cancer. 2017 Feb 7;16(1):35. | ||||
| REF 27 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
| REF 28 | MicroRNA-224 negatively regulates p21 expression during late neoplastic progression in inflammatory bowel disease.Inflamm Bowel Dis. 2013 Mar;19(3):471-80. | ||||
| REF 29 | MicroRNA-224 inhibits progression of human prostate cancer by downregulating TRIB1.Int J Cancer. 2014 Aug 1;135(3):541-50. | ||||
| REF 30 | Tumour-suppressive microRNA-224 inhibits cancer cell migration and invasion via targeting oncogenic TPD52 in prostate cancer.FEBS Lett. 2014 May 21;588(10):1973-82. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.