miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-23a-5p | ||||
| miRNA Stemloop AC | MI0000079 | ||||
| miRNA Stemloop ID | hsa-mir-23a | ||||
| Sequence | gggguuccuggggaugggauuu | ||||
| TTD Target(s) Regulated by This miRNA | Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [1] | |
| Toll-like receptor 2 (TLR2) | Clinical trial Target | Target Info | [2] | ||
| Gap junction alpha-1 protein (GJA1) | Clinical trial Target | Target Info | [3] | ||
| Lysosome-associated membrane glycoprotein 1 (CD107a) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Apoptotic protease-activating factor 1 | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439. | ||||
| REF 2 | MiR-23a-5p modulates mycobacterial survival and autophagy during mycobacterium tuberculosis infection through TLR2/MyD88/NF-B pathway by targeting TLR2. Exp Cell Res. 2017 May 15;354(2):71-77. | ||||
| REF 3 | MicroRNA-23a participates in estrogen deficiency induced gap junction remodeling of rats by targeting GJA1. Int J Biol Sci. 2015 Feb 15;11(4):390-403. | ||||
| REF 4 | Hypoxic tumor-derived microvesicles negatively regulate NK cell function by a mechanism involving TGF- and miR23a transfer. Oncoimmunology. 2015 Jun 24;5(4):e1062968. | ||||
| REF 5 | Upregulation of microRNA-23a regulates proliferation and apoptosis by targeting APAF-1 in laryngeal carcinoma. Oncol Lett. 2015 Jul;10(1):410-416. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.