miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-25-3p | ||||
| miRNA Stemloop AC | MI0000082 | ||||
| miRNA Stemloop ID | hsa-mir-25 | ||||
| Sequence | cauugcacuugucucggucuga | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Dihydrofolate reductase (DHFR) | Successful Target | Target Info | [2] | ||
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [3] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [4] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [5] | ||
| Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (ATP2A2) | Clinical trial Target | Target Info | [6] | ||
| TNF related apoptosis inducing ligand (TNFSF10) | Clinical trial Target | Target Info | [7] | ||
| Collagen I (COL1A2) | Clinical trial Target | Target Info | [8] | ||
| Protein arginine methyltransferase 5 (PRMT5) | Clinical trial Target | Target Info | [9] | ||
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [10] | ||
| Cytochrome P450 2B6 (CYP2B6) | Literature-reported Target | Target Info | [11] | ||
| Histone acetyltransferase KAT2B (KAT2B) | Literature-reported Target | Target Info | [12] | ||
| Large tumor suppressor homolog 2 (LATS2) | Literature-reported Target | Target Info | [13] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [14] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [15] | ||
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [16] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [17] | ||
| CDK inhibitor 1C p57Kip2 (CDKN1C) | Literature-reported Target | Target Info | [18] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [19] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [20] | ||
| C-C motif chemokine 26 | Regulated Protein | [3] | |||
| Cytoplasmic polyadenylation element-binding protein 1 | Regulated Protein | [22] | |||
| Desmocollin-2 | Regulated Protein | [23] | |||
| DNA polymerase zeta catalytic subunit | Regulated Protein | [24] | |||
| Dual specificity mitogen-activated protein kinase kinase 4 | Regulated Protein | [7] | |||
| Heart- and neural crest derivatives-expressed protein 2 | Regulated Protein | [26] | |||
| Regulator of G-protein signaling 3 | Regulated Protein | [27] | |||
| Semaphorin-4C | Regulated Protein | [28] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [29] | |||
| tRNA (guanine-N(7)-)-methyltransferase non-catalytic subunit WDR4 | Regulated Protein | [30] | |||
| References | |||||
| REF 1 | MicroRNA-25 promotes gastric cancer migration, invasion and proliferation by directly targeting transducer of ERBB2, 1 and correlates with poor survival. Oncogene. 2015 May 14;34(20):2556-65. | ||||
| REF 2 | A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer. J Biol Chem. 2017 Mar 24;292(12):4873-4884. | ||||
| REF 3 | MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5316-21. | ||||
| REF 4 | Negative regulation of the tumor suppressor p53 gene by microRNAs. Oncogene. 2011 Feb 17;30(7):843-53. | ||||
| REF 5 | Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. J Clin Endocrinol Metab. 2012 May;97(5):E710-8. | ||||
| REF 6 | Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 2014 Apr 24;508(7497):531-5. | ||||
| REF 7 | Altered expression of mir-222 and mir-25 influences diverse gene expression changes in transformed normal and anaplastic thyroidells, and impacts on MEK and TRAIL protein expression. Int J Mol Med. 2016 Aug;38(2):433-45. | ||||
| REF 8 | Amplified 7q21-22 gene MCM7 and its intronic miR-25 suppress COL1A2 associated genes to sustain intestinal gastric cancer features. Mol Carcinog. 2017 Jun;56(6):1590-1602. | ||||
| REF 9 | Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol Cell Biol. 2008 Oct;28(20):6262-77. | ||||
| REF 10 | MicroRNA expression in human airway smooth muscle cells: role of miR-25 in regulation of airway smooth muscle phenotype. Am J Respir Cell Mol Biol. 2010 Apr;42(4):506-13. | ||||
| REF 11 | MicroRNA hsa-miR-25-3p suppresses the expression and drug induction of CYP2B6 in human hepatocytes. Biochem Pharmacol. 2016 Aug 1;113:88-96. | ||||
| REF 12 | MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90. | ||||
| REF 13 | miR-107 and miR-25 simultaneously target LATS2 and regulate proliferation and invasion of gastric adenocarcinoma (GAC) cells. Biochem Biophys Res Commun. 2015 May 8;460(3):806-12. | ||||
| REF 14 | Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010 Apr 13;3(117):ra29. | ||||
| REF 15 | Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification). Nucleic Acids Res. 2014 Apr;42(8):e66. | ||||
| REF 16 | MicroRNA-25 promotes cell migration and invasion in esophageal squamous cell carcinoma. Biochem Biophys Res Commun. 2012 May 18;421(4):640-5. | ||||
| REF 17 | p53 Mutation Directs AURKA Overexpression via miR-25 and FBXW7 in Prostatic Small Cell Neuroendocrine Carcinoma. Mol Cancer Res. 2015 Mar;13(3):584-91. | ||||
| REF 18 | Functional links between clustered microRNAs: suppression of cell-cycle inhibitors by microRNA clusters in gastric cancer. Nucleic Acids Res. 2009 Apr;37(5):1672-81. | ||||
| REF 19 | MiR-25 promotes gastric cancer cells growth and motility by targeting RECK. Mol Cell Biochem. 2014 Jan;385(1-2):207-13. | ||||
| REF 20 | E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer. Cancer Cell. 2008 Mar;13(3):272-86. | ||||
| REF 21 | MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5316-21. | ||||
| REF 22 | MiR-25 suppresses 3T3-L1 adipogenesis by directly targeting KLF4 and C/EBP. J Cell Biochem. 2015 Nov;116(11):2658-66. | ||||
| REF 23 | Down-regulated desmocollin-2 promotes cell aggressiveness through redistributing adherens junctions and activating beta-catenin signalling in oesophageal squamous cell carcinoma.J Pathol. 2013 Oct;231(2):257-70. | ||||
| REF 24 | REV3L 3'UTR 460 T>C polymorphism in microRNA target sites contributes to lung cancer susceptibility.Oncogene. 2013 Jan 10;32(2):242-50. | ||||
| REF 25 | Altered expression of mir-222 and mir-25 influences diverse gene expression changes in transformed normal and anaplastic thyroidells, and impacts on MEK and TRAIL protein expression. Int J Mol Med. 2016 Aug;38(2):433-45. | ||||
| REF 26 | Nfat and miR-25 cooperate to reactivate the transcription factor Hand2 in heart failure.Nat Cell Biol. 2013 Nov;15(11):1282-93. | ||||
| REF 27 | Elevated microRNA-25 inhibits cell apoptosis in lung cancer by targeting RGS3.In Vitro Cell Dev Biol Anim. 2016 Jan;52(1):62-7. | ||||
| REF 28 | miR-25-3p reverses epithelial-mesenchymal transition via targeting Sema4C in cisplatin-resistance cervical cancer cells.Cancer Sci. 2017 Jan;108(1):23-31. | ||||
| REF 29 | TSA suppresses miR-106b-93-25 cluster expression through downregulation of MYC and inhibits proliferation and induces apoptosis in human EMC.PLoS One. 2012;7(9):e45133. | ||||
| REF 30 | miR-25 targets TNF-related apoptosis inducing ligand (TRAIL) death receptor-4 and promotes apoptosis resistance in cholangiocarcinoma.Hepatology. 2012 Feb;55(2):465-75. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.