miRNA General Information
miRNA Mature ID	hsa-miR-25-5p
miRNA Stemloop AC	MI0000082
miRNA Stemloop ID	hsa-mir-25
Sequence	aggcggagacuugggcaauug
TTD Target(s) Regulated by This miRNA	Protein kinase C zeta (PRKCZ)	Patented-recorded Target	Target Info	[1]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[2]
	G1/S-specific cyclin-E1 (CCNE1)	Literature-reported Target	Target Info	[2]
References
REF 1	microRNA-25 targets PKC and protects osteoblastic cells from dexamethasone via activating AMPK signaling. Oncotarget. 2017 Jan 10;8(2):3226-3236.
REF 2	microRNA-25 Inhibits Cell Apoptosis of Human Gastric Adenocarcinoma Cell Line AGS via Regulating CCNE1 and MYC. Med Sci Monit. 2016 Apr 27;22:1415-20.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.