miRNA General Information
miRNA Mature ID	hsa-miR-26a-5p
miRNA Stemloop AC	MI0000083 | MI0000750
miRNA Stemloop ID	hsa-mir-26a-1 | hsa-mir-26a-2
Sequence	uucaaguaauccaggauaggcu
TTD Target(s) Regulated by This miRNA	Enhancer of zeste homolog 2 (EZH2)	Successful Target	Target Info	[1]
	TGF-beta receptor type II (TGFBR2)	Clinical trial Target	Target Info	[2]
Protein(s) Regulated by This miRNA	ADP-ribosylation factor-like protein 4C	Regulated Protein	ARL4C_HUMAN	[3]
	Alpha-(1,6)-fucosyltransferase	Regulated Protein	FUT8_HUMAN	[4]
	Alpha-methylacyl-CoA racemase	Regulated Protein	AMACR_HUMAN	[5]
	BAG family molecular chaperone regulator 4	Regulated Protein	BAG4_HUMAN	[6]
	Cell division control protein 6 homolog	Regulated Protein	CDC6_HUMAN	[1]
	Chromodomain-helicase-DNA-binding protein 1	Regulated Protein	CHD1_HUMAN	[8]
	Cyclin-dependent kinases regulatory subunit 2	Regulated Protein	CKS2_HUMAN	[9]
	Cytoplasmic polyadenylation element-binding protein 2	Regulated Protein	CPEB2_HUMAN	[10]
	Cytoplasmic polyadenylation element-binding protein 3	Regulated Protein	CPEB3_HUMAN	[10]
	Cytoplasmic polyadenylation element-binding protein 4	Regulated Protein	CPEB4_HUMAN	[10]
	Dual specificity protein phosphatase 4	Regulated Protein	DUS4_HUMAN	[11]
	Fibroblast growth factor 9	Regulated Protein	FGF9_HUMAN	[12]
	G/T mismatch-specific thymine DNA glycosylase	Regulated Protein	TDG_HUMAN	[13]
	G1/S-specific cyclin-D2	Regulated Protein	CCND2_HUMAN	[14]
	Ganglioside-induced differentiation-associated protein 1	Regulated Protein	GDAP1_HUMAN	[15]
	La-related protein 1	Regulated Protein	LARP1_HUMAN	[16]
	Methylcytosine dioxygenase TET2	Regulated Protein	TET2_HUMAN	[13]
	Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[17]
	Mucosa-associated lymphoid tissue lymphoma translocation protein 1	Regulated Protein	MALT1_HUMAN	[18]
	Phosphatidylinositol 4-phosphate 3-kinase C2 domain-containing subunit alpha	Regulated Protein	P3C2A_HUMAN	[19]
	Plasminogen activator inhibitor 1 RNA-binding protein	Regulated Protein	PAIRB_HUMAN	[20]
	Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2	Regulated Protein	PLOD2_HUMAN	[21]
	Protein jagged-1	Regulated Protein	JAG1_HUMAN	[22]
	Protein lin-28 homolog B	Regulated Protein	LN28B_HUMAN	[23]
	RCC1 and BTB domain-containing protein 1	Regulated Protein	RCBT1_HUMAN	[24]
	Retinoblastoma-associated protein	Regulated Protein	RB_HUMAN	[25]
	STE20-related kinase adapter protein beta	Regulated Protein	STRAB_HUMAN	[1]
	Terminal uridylyltransferase 4	Regulated Protein	TUT4_HUMAN	[23]
	Thioredoxin-dependent peroxide reductase, mitochondrial	Regulated Protein	PRDX3_HUMAN	[26]
	Transcription factor E2F7	Regulated Protein	E2F7_HUMAN	[27]
	Type 2 lactosamine alpha-2,3-sialyltransferase	Regulated Protein	SIA10_HUMAN	[28]
	Zinc finger protein PLAG1	Regulated Protein	PLAG1_HUMAN	[2]
References
REF 1	MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood. 2008 Nov 15;112(10):4202-12.
REF 2	A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61.
REF 3	MiR-26 controls LXR-dependent cholesterol efflux by targeting ABCA1 and ARL7. FEBS Lett. 2012 May 21;586(10):1472-9.
REF 4	Comprehensive N-glycan profiles of hepatocellular carcinoma reveal association of fucosylation with tumor progression and regulation of FUT8 by microRNAs.Oncotarget. 2016 Sep 20;7(38):61199-61214.
REF 5	Elevated expression of prostate cancer-associated genes is linked to down-regulation of microRNAs.BMC Cancer. 2014 Feb 11;14:82.
REF 6	MicroRNA-26a is strongly downregulated in melanoma and induces cell death through repression of silencer of death domains (SODD).J Invest Dermatol. 2013 May;133(5):1286-93.
REF 7	MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood. 2008 Nov 15;112(10):4202-12.
REF 8	Identification of miR-26 as a key mediator of estrogen stimulated cell proliferation by targeting CHD1, GREB1 and KPNA2.Breast Cancer Res. 2014 Apr 15;16(2):R40.
REF 9	miR-26a and its target CKS2 modulate cell growth and tumorigenesis of papillary thyroid carcinoma.PLoS One. 2013 Jul 5;8(7):e67591.
REF 10	CPEB2, CPEB3 and CPEB4 are coordinately regulated by miRNAs recognizing conserved binding sites in paralog positions of their 3'-UTRs.Nucleic Acids Res. 2010 Nov;38(21):7698-710.
REF 11	MiR-26a enhances autophagy to protect against ethanol-induced acute liver injury.J Mol Med (Berl). 2015 Sep;93(9):1045-55.
REF 12	miR-26a suppresses tumor growth and metastasis by targeting FGF9 in gastric cancer.PLoS One. 2013 Aug 28;8(8):e72662.
REF 13	MicroRNA-26a targets ten eleven translocation enzymes and is regulated during pancreatic cell differentiation.Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17892-7.
REF 14	Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model.Cell. 2009 Jun 12;137(6):1005-17.
REF 15	A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 16	MicroRNA-26a/b directly regulate La-related protein 1 and inhibit cancer cell invasion in prostate cancer.Int J Oncol. 2015 Aug;47(2):710-8.
REF 17	MicroRNA-26a is a novel regulator of vascular smooth muscle cell function.J Cell Physiol. 2011 Apr;226(4):1035-43.
REF 18	MiR-26 down-regulates TNF-/NF-B signalling and IL-6 expression by silencing HMGA1 and MALT1.Nucleic Acids Res. 2016 May 5;44(8):3772-87.
REF 19	MicroRNA-26a inhibits angiogenesis by down-regulating VEGFA through the PIK3C2/Akt/HIF-1 pathway in hepatocellular carcinoma.PLoS One. 2013 Oct 23;8(10):e77957.
REF 20	Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.
REF 21	Regulation of the collagen cross-linking enzymes LOXL2 and PLOD2 by tumor-suppressive microRNA-26a/b in renal cell carcinoma.Int J Oncol. 2016 May;48(5):1837-46.
REF 22	MiR-26a inhibits stem cell-like phenotype and tumor growth of osteosarcoma by targeting Jagged1.Oncogene. 2017 Jan 12;36(2):231-241.
REF 23	miR-26a enhances miRNA biogenesis by targeting Lin28B and Zcchc11 to suppress tumor growth and metastasis.Oncogene. 2014 Aug 21;33(34):4296-306.
REF 24	Overexpression of miR-26a-2 in human liposarcoma is correlated with poor patient survival.Oncogenesis. 2013 May 20;2:e47.
REF 25	Integrative genome analysis reveals an oncomir/oncogene cluster regulating glioblastoma survivorship.Proc Natl Acad Sci U S A. 2010 Feb 2;107(5):2183-8.
REF 26	MicroRNA-26a-5p and microRNA-23b-3p up-regulate peroxiredoxin III in acute myeloid leukemia.Leuk Lymphoma. 2015 Feb;56(2):460-71.
REF 27	The microRNA-26a target E2F7 sustains cell proliferation and inhibits monocytic differentiation of acute myeloid leukemia cells.Cell Death Dis. 2012 Oct 25;3:e413.
REF 28	Sialyltransferase ST3GAL6 mediates the effect of microRNA-26a on cell growth, migration, and invasion in hepatocellular carcinoma through the protein kinase B/mammalian target of rapamycin pathway.Cancer Sci. 2017 Feb;108(2):267-276.
REF 29	A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.