miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-26b-3p | ||||
| miRNA Stemloop AC | MI0000084 | ||||
| miRNA Stemloop ID | hsa-mir-26b | ||||
| Sequence | ccuguucuccauuacuuggcu | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Prostaglandin G/H synthase 2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-26b-3p Regulates Human Umbilical Cord-Derived Mesenchymal Stem Cell Proliferation by Targeting Estrogen Receptor. Stem Cells Dev. 2016 Mar 1;25(5):415-26. | ||||
| REF 2 | [MiR-26b inhibits proliferation, invasion, and migration of glioma by targeting cyclooxygenase-2].Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2017 Feb 28;42(2):139-146. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.