miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-27b-3p
miRNA Stemloop AC MI0000440
miRNA Stemloop ID hsa-mir-27b
Sequence uucacaguggcuaaguucugc
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Proto-oncogene c-Ret (RET) Successful Target Target Info [2]
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) Successful Target Target Info [3]
Proto-oncogene c-Met (MET) Successful Target Target Info [1]
Vitamin D3 receptor (VDR) Successful Target Target Info [4]
ATP-binding cassette transporter A1 (ABCA1) Successful Target Target Info [5]
Adenosine A2b receptor (ADORA2B) Successful Target Target Info [6]
Endothelin A receptor (EDNRA) Successful Target Target Info [7]
Low-density lipoprotein receptor (LDL-R) Successful Target Target Info [8]
Dihydrothymine dehydrogenase (DPYD) Successful Target Target Info [9]
Albendazole monooxygenase (CYP3A4) Clinical trial Target Target Info [4]
Matrix metalloproteinase-13 (MMP-13) Clinical trial Target Target Info [10]
TGF-beta receptor type I (TGFBR1) Clinical trial Target Target Info [11]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [12]
Cytochrome P450 1B1 (CYP1B1) Clinical trial Target Target Info [13]
Frizzled-7 receptor (FZD7) Clinical trial Target Target Info [14]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [15]
Vascular endothelial growth factor C (VEGFC) Clinical trial Target Target Info [16]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [17]
Osteoblast cadherin (CDH11) Clinical trial Target Target Info [18]
Suppressor of tumorigenicity 14 protein (ST14) Patented-recorded Target Target Info [19]
Polo-like kinase 2 (PLK2) Patented-recorded Target Target Info [20]
Cyclin A2 (CCNA2) Literature-reported Target Target Info [21]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [22]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [23]
Liver receptor homolog-1 (NR5A2) Literature-reported Target Target Info [24]
Fractalkine (CX3CL1) Literature-reported Target Target Info [25]
Prohibitin (PHB) Literature-reported Target Target Info [26]
Vascular endothelial cadherin (CDH5) Literature-reported Target Target Info [27]
Protein(s) Regulated by This miRNA #VALUE! Regulated Protein
Q2VCE5_HUMAN
[28]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 Regulated Protein
BNIP3_HUMAN
[29]
Calcium-binding protein 39-like Regulated Protein
CB39L_HUMAN
[29]
Calponin-3 Regulated Protein
CNN3_HUMAN
[29]
COUP transcription factor 2 Regulated Protein
COT2_HUMAN
[30]
Cyclin-G1 Regulated Protein
CCNG1_HUMAN
[31]
Cyclin-T1 Regulated Protein
CCNT1_HUMAN
[32]
Cyclin-Y-like protein 1 Regulated Protein
CCYL1_HUMAN
[29]
Cysteine-rich secretory protein 2 Regulated Protein
CRIS2_HUMAN
[29]
E3 ubiquitin-protein transferase RMND5A Regulated Protein
RMD5A_HUMAN
[29]
Eyes absent homolog 4 Regulated Protein
EYA4_HUMAN
[7]
Far upstream element-binding protein 2 Regulated Protein
FUBP2_HUMAN
[34]
Forkhead box protein J3 Regulated Protein
FOXJ3_HUMAN
[35]
High mobility group protein B3 Regulated Protein
HMGB3_HUMAN
[36]
Huntingtin-interacting protein 1-related protein Regulated Protein
HIP1R_HUMAN
[37]
Inactive tyrosine-protein kinase transmembrane receptor ROR1 Regulated Protein
ROR1_HUMAN
[38]
Mitochondrial fission factor Regulated Protein
MFF_HUMAN
[39]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[11]
Oxysterol-binding protein-related protein 6 Regulated Protein
OSBL6_HUMAN
[41]
Paired box protein Pax-3 Regulated Protein
PAX3_HUMAN
[42]
Paired box protein Pax-7 Regulated Protein
PAX7_HUMAN
[42]
Phosphatidate phosphatase LPIN1 Regulated Protein
LPIN1_HUMAN
[29]
Poly(U)-specific endoribonuclease Regulated Protein
ENDOU_HUMAN
[29]
Prosaposin Regulated Protein
SAP_HUMAN
[43]
Runt-related transcription factor 1 Regulated Protein
RUNX1_HUMAN
[44]
Semaphorin-6A Regulated Protein
SEM6A_HUMAN
[45]
Serine/threonine-protein kinase PINK1, mitochondrial Regulated Protein
PINK1_HUMAN
[46]
Serine/threonine-protein kinase WNK1 Regulated Protein
WNK1_HUMAN
[29]
Serine/threonine-protein phosphatase CPPED1 Regulated Protein
CPPED_HUMAN
[29]
SHC-transforming protein 1 Regulated Protein
SHC1_HUMAN
[17]
Thrombospondin-2 Regulated Protein
TSP2_HUMAN
[17]
Trafficking protein particle complex subunit 2B Regulated Protein
TPC2B_HUMAN
[48]
References
REF 1 Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancer. Int J Oncol. 2015 Feb;46(2):487-96.
REF 2 Acute myeloid leukemia with translocation (8;16)(p11;p13) and MYST3-CREBBP rearrangement harbors a distinctive microRNA signature targeting RET proto-oncogene. Leukemia. 2013 Mar;27(3):595-603.
REF 3 microRNA miR-27b impairs human adipocyte differentiation and targets PPARgamma. Biochem Biophys Res Commun. 2009 Dec 11;390(2):247-51.
REF 4 MicroRNAs regulate CYP3A4 expression via direct and indirect targeting. Drug Metab Dispos. 2009 Oct;37(10):2112-7.
REF 5 MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages. Atherosclerosis. 2014 May;234(1):54-64.
REF 6 Adenosine 2B receptor expression is post-transcriptionally regulated by microRNA. J Biol Chem. 2010 Jun 11;285(24):18184-90.
REF 7 A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 8 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
REF 9 microRNAs miR-27a and miR-27b directly regulate liver dihydropyrimidine dehydrogenase expression through two conserved binding sites. Mol Cancer Ther. 2014 Mar;13(3):742-51.
REF 10 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82.
REF 11 miR-27b inhibits fibroblast activation via targeting TGF signaling pathway. BMC Cell Biol. 2017 Jan 17;18(1):9.
REF 12 Prediction of Associations between microRNAs and Gene Expression in Glioma Biology. PLoS One. 2011 Feb 16;6(2):e14681.
REF 13 MicroRNA regulates the expression of human cytochrome P450 1B1. Cancer Res. 2006 Sep 15;66(18):9090-8.
REF 14 MicroRNA-27b suppresses Helicobacter pylori-induced gastric tumorigenesis through negatively regulating Frizzled7. Oncol Rep. 2016 Apr;35(4):2441-50.
REF 15 Exploration of human miRNA target genes in neuronal differentiation. Nucleic Acids Symp Ser (Oxf). 2005;(49):341-2.
REF 16 MicroRNA-27b, microRNA-101 and microRNA-128 inhibit angiogenesis by down-regulating vascular endothelial growth factor C expression in gastric cancers. Oncotarget. 2015 Nov 10;6(35):37458-70.
REF 17 MicroRNA miR-27b rescues bone marrow-derived angiogenic cell function and accelerates wound healing in type 2 diabetes mellitus. Arterioscler Thromb Vasc Biol. 2014 Jan;34(1):99-109.
REF 18 miR-27b is upregulated in cervical carcinogenesis and promotes cell growth and invasion by regulating CDH11 and epithelial-mesenchymal transition. Oncol Rep. 2016 Mar;35(3):1645-51.
REF 19 ST14 (suppression of tumorigenicity 14) gene is a target for miR-27b, and the inhibitory effect of ST14 on cell growth is independent of miR-27b regulation. J Biol Chem. 2009 Aug 21;284(34):23094-106.
REF 20 MicroRNA-27b up-regulated by human papillomavirus 16 E7 promotes proliferation and suppresses apoptosis by targeting polo-like kinase2 in cervical cancer. Oncotarget. 2016 Apr 12;7(15):19666-79.
REF 21 Ionizing radiation-inducible miR-27b suppresses leukemia proliferation via targeting cyclin A2. Int J Radiat Oncol Biol Phys. 2014 Sep 1;90(1):53-62.
REF 22 High expression of cAMP-responsive element-binding protein 1 (CREB1) is associated with metastasis, tumor stage and poor outcome in gastric cancer. Oncotarget. 2015 Apr 30;6(12):10646-57.
REF 23 miR-27b overexpression improves mitochondrial function in a Sirt1-dependent manner. J Physiol Biochem. 2015 Dec;71(4):753-62.
REF 24 Downregulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Cell Death Dis. 2016 Nov 3;7(11):e2454.
REF 25 Upregulation of KSRP by miR-27b provides IFN--induced post-transcriptional regulation of CX3CL1 in liver epithelial cells. Sci Rep. 2015 Dec 3;5:17590.
REF 26 MicroRNA-27 (miR-27) targets prohibitin and impairs adipocyte differentiation and mitochondrial function in human adipose-derived stem cells. J Biol Chem. 2013 Nov 29;288(48):34394-402.
REF 27 MicroRNA-27b functions as a new inhibitor of ovarian cancer-mediated vasculogenic mimicry through suppression of VE-cadherin expression. RNA. 2017 Jul;23(7):1019-1027.
REF 28 Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b.Med Sci Monit. 2016 Oct 1;22:3506-3513.
REF 29 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 30 miR-27b inhibits gastric cancer metastasis by targeting NR2F2.Protein Cell. 2017 Feb;8(2):114-122.
REF 31 The miR27b-CCNG1-P53-miR-508-5p axis regulates multidrug resistance of gastric cancer.Oncotarget. 2016 Jan 5;7(1):538-49.
REF 32 Regulation of cyclin T1 and HIV-1 Replication by microRNAs in resting CD4+ T lymphocytes.J Virol. 2012 Mar;86(6):3244-52.
REF 33 A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 34 miR-27b targets KSRP to coordinate TLR4-mediated epithelial defense against Cryptosporidium parvum infection.PLoS Pathog. 2012;8(5):e1002702.
REF 35 MicroRNA-27b Regulates Mitochondria Biogenesis in Myocytes.PLoS One. 2016 Feb 5;11(2):e0148532.
REF 36 MiR-27b is epigenetically downregulated in tamoxifen resistant breast cancer cells due to promoter methylation and regulates tamoxifen sensitivity by targeting HMGB3.Biochem Biophys Res Commun. 2016 Sep 2;477(4):768-773.
REF 37 The microRNA-23b/-27b cluster suppresses prostate cancer metastasis via Huntingtin-interacting protein 1-related.Oncogene. 2016 Sep 8;35(36):4752-61.
REF 38 miR-27b-3p suppresses cell proliferation through targeting receptor tyrosine kinase like orphan receptor 1 in gastric cancer.J Exp Clin Cancer Res. 2015 Nov 14;34:139.
REF 39 miR-27 regulates mitochondrial networks by directly targeting the mitochondrial fission factor.Exp Mol Med. 2014 Nov 28;46:e123.
REF 40 miR-27b inhibits fibroblast activation via targeting TGF signaling pathway. BMC Cell Biol. 2017 Jan 17;18(1):9.
REF 41 miRNA Targeting of Oxysterol-Binding Protein-Like 6 Regulates Cholesterol Trafficking and Efflux.Arterioscler Thromb Vasc Biol. 2016 May;36(5):942-951.
REF 42 Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression.Proc Natl Acad Sci U S A. 2009 Aug 11;106(32):13383-7.
REF 43 The microRNA-23b/27b/24 cluster promotes breast cancer lung metastasis by targeting metastasis-suppressive gene prosaposin.J Biol Chem. 2014 Aug 8;289(32):21888-95.
REF 44 miR-27b attenuates apoptosis induced by transmissible gastroenteritis virus (TGEV) infection via targeting runt-related transcription factor 1 (RUNX1).PeerJ. 2016 Feb 4;4:e1635.
REF 45 MicroRNA-27a/b controls endothelial cell repulsion and angiogenesis by targeting semaphorin 6A.Blood. 2012 Feb 9;119(6):1607-16.
REF 46 miR-27a and miR-27b regulate autophagic clearance of damaged mitochondria by targeting PTEN-induced putative kinase 1 (PINK1).Mol Neurodegener. 2016 Jul 26;11(1):55.
REF 47 MicroRNA miR-27b rescues bone marrow-derived angiogenic cell function and accelerates wound healing in type 2 diabetes mellitus. Arterioscler Thromb Vasc Biol. 2014 Jan;34(1):99-109.
REF 48 MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.