miRNA General Information
miRNA Mature ID hsa-miR-29a-3p
miRNA Stemloop AC MI0000087
miRNA Stemloop ID hsa-mir-29a
Sequence uagcaccaucugaaaucgguua
TTD Target(s) Regulated by This miRNA HMG-CoA reductase (HMGCR) Successful Target Target Info [1]
Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [2]
Proto-oncogene c-Ret (RET) Successful Target Target Info [3]
Tyrosine-protein kinase ABL1 (ABL) Successful Target Target Info [4]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [5]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [6]
Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [7]
Calcitonin receptor (CALCR) Successful Target Target Info [8]
Lipoprotein lipase (LPL) Successful Target Target Info [9]
Succinate-semialdehyde dehydrogenase (ALDH5A1) Successful Target Target Info [10]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [11]
Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) Successful Target Target Info [12]
Aryl hydrocarbon receptor (AHR) Successful Target Target Info [1]
Glycogen synthase kinase-3 beta (GSK-3B) Clinical trial Target Target Info [13]
Cyclin-dependent kinase 2 (CDK2) Clinical trial Target Target Info [5]
RAC-gamma serine/threonine-protein kinase (AKT3) Clinical trial Target Target Info [14]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [15]
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Clinical trial Target Target Info [16]
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Clinical trial Target Target Info [17]
Integrin beta-1 (ITGB1) Clinical trial Target Target Info [18]
Beta-secretase 1 (BACE1) Clinical trial Target Target Info [19]
CDC7-related kinase (CDC7) Clinical trial Target Target Info [20]
Dickkopf-related protein 1 (DKK1) Clinical trial Target Target Info [21]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [5]
B7 homolog 3 (CD276) Clinical trial Target Target Info [22]
Collagen I (COL1A2) Clinical trial Target Target Info [23]
Interferon alpha/beta receptor 1 (IFNAR1) Clinical trial Target Target Info [24]
Mucin-1 (MUC1) Clinical trial Target Target Info [25]
Transforming growth factor beta 3 (TGFB3) Clinical trial Target Target Info [3]
S100 calcium-binding protein B (S100B) Clinical trial Target Target Info [26]
Insulin-like growth factor-I (IGF1) Clinical trial Target Target Info [27]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [28]
DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Patented-recorded Target Target Info [16]
Glutamate decarboxylase (GLUL) Discontinued Target Target Info [29]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [30]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [31]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [32]
Lysine-specific demethylase 5B (KDM5B) Literature-reported Target Target Info [33]
Ribonuclease L (RNASEL) Literature-reported Target Target Info [34]
Zinc finger protein A20 (TNFAIP3) Literature-reported Target Target Info [35]
Dystroglycan (DAG1) Literature-reported Target Target Info [3]
Fibrinogen (FGG) Literature-reported Target Target Info [36]
Lysyl oxidase (LOX) Literature-reported Target Target Info [2]
Normal cross-reacting antigen (CD66c) Clinical trial Target Target Info [37]
Protein phosphatase 1D (PPM1D) Literature-reported Target Target Info [38]
Direct IAP-binding protein with low pI (DIABLO) Literature-reported Target Target Info [3]
Integrin alpha-11 (ITGA11) Literature-reported Target Target Info [39]
Integrin alpha-6 (ITGA6) Literature-reported Target Target Info [40]
Laminin gamma-2 subunit (LAMC2) Literature-reported Target Target Info [41]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [42]
Osteonectin (SPARC) Literature-reported Target Target Info [43]
Super conserved receptor brain 2 (GPR85) Literature-reported Target Target Info [8]
Protein(s) Regulated by This miRNA A disintegrin and metalloproteinase with thrombospondin motifs 9 Regulated Protein [39]
Apoptosis-stimulating of p53 protein 1 Regulated Protein [45]
Autophagy-related protein 9A Regulated Protein [46]
B-cell CLL/lymphoma 7 protein family member A Regulated Protein [47]
Beta/gamma crystallin domain-containing protein 1 Regulated Protein [48]
Cell division control protein 42 homolog Regulated Protein [45]
Claudin-1 Regulated Protein [49]
Collagen alpha-1(III) chain Regulated Protein [2]
Collagen alpha-1(IV) chain Regulated Protein [2]
Collagen alpha-1(X) chain Regulated Protein [2]
Collagen alpha-2(IV) chain Regulated Protein [51]
Collagen alpha-2(V) chain Regulated Protein [2]
Complement C1q tumor necrosis factor-related protein 6 Regulated Protein [52]
Complement component C1q receptor Regulated Protein [8]
Cyclin-T2 Regulated Protein [54]
Cytochrome P450 2C19 Regulated Protein [55]
Cytoplasmic polyadenylation element-binding protein 3 Regulated Protein [56]
Cytoplasmic polyadenylation element-binding protein 4 Regulated Protein [56]
Desmocollin-2 Regulated Protein [48]
Disintegrin and metalloproteinase domain-containing protein 12 Regulated Protein [57]
E3 ubiquitin-protein ligase AMFR Regulated Protein [48]
E3 ubiquitin-protein ligase TRIM63 Regulated Protein [3]
E3 ubiquitin-protein ligase TRIM68 Regulated Protein [59]
Elastin Regulated Protein [60]
Epithelial membrane protein 1 Regulated Protein [48]
Fibrillin-1 Regulated Protein [2]
Fibrinogen alpha chain Regulated Protein [36]
Fibrinogen beta chain Regulated Protein [36]
Forkhead box protein O3 Regulated Protein [62]
G/T mismatch-specific thymine DNA glycosylase Regulated Protein [63]
G1/S-specific cyclin-D2 Regulated Protein [64]
GTP-binding nuclear protein Ran Regulated Protein [65]
Histone-lysine N-methyltransferase SETDB1 Regulated Protein [66]
HMG box-containing protein 1 Regulated Protein [67]
Inter-alpha-trypsin inhibitor heavy chain H5 Regulated Protein [47]
Kremen protein 2 Regulated Protein [21]
Max dimerization protein 1 Regulated Protein [48]
Methylcytosine dioxygenase TET1 Regulated Protein [69]
Methylcytosine dioxygenase TET2 Regulated Protein [70]
Methylcytosine dioxygenase TET3 Regulated Protein [70]
N-myc-interactor Regulated Protein [71]
Neuron navigator 3 Regulated Protein [72]
Nuclear autoantigenic sperm protein Regulated Protein [73]
Nuclear factor 1 A-type Regulated Protein [8]
Nuclear factor 1 A-type Regulated Protein [74]
Period circadian protein homolog 1 Regulated Protein [75]
Peroxidasin homolog Regulated Protein [47]
Phosphatase and actin regulator 2 Regulated Protein [48]
Phosphatidylinositol 3-kinase regulatory subunit alpha Regulated Protein [76]
Protein quaking Regulated Protein [77]
RAS guanyl-releasing protein 1 Regulated Protein [23]
Roundabout homolog 1 Regulated Protein [79]
Secreted frizzled-related protein 2 Regulated Protein [21]
Serine/threonine-protein kinase RIO3 Regulated Protein [48]
Serpin B9 Regulated Protein [80]
Serpin H1 Regulated Protein [81]
SLIT-ROBO Rho GTPase-activating protein 2 Regulated Protein [8]
Solute carrier family 22 member 7 Regulated Protein [10]
Sorting nexin-24 Regulated Protein [48]
Suppressor APC domain-containing protein 2 Regulated Protein [83]
TNF receptor-associated factor 4 Regulated Protein [84]
Transcription factor EB Regulated Protein [46]
Tubulin beta-2A chain Regulated Protein [48]
Voltage-dependent anion-selective channel protein 1 Regulated Protein [85]
WD repeat-containing protein 26 Regulated Protein [48]
Zinc finger protein 823 Regulated Protein [86]
References
REF 1 Inhibition of miR-29 has a significant lipid-lowering benefit through suppression of lipogenic programs in liver. Sci Rep. 2015 Aug 6;5:12911.
REF 2 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 3 Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.
REF 4 miR-29b suppresses CML cell proliferation and induces apoptosis via regulation of BCR/ABL1 protein. Exp Cell Res. 2013 May 1;319(8):1094-101.
REF 5 Reduced miR-29a-3p expression is linked to the cell proliferation and cell migration in gastric cancer. World J Surg Oncol. 2015 Mar 12;13:101.
REF 6 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 7 Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. Hepatology. 2010 Mar;51(3):836-45.
REF 8 miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. J Biol Chem. 2013 Nov 15;288(46):33347-60.
REF 9 MicroRNA-29a regulates pro-inflammatory cytokine secretion and scavenger receptor expression by targeting LPL in oxLDL-stimulated dendritic cells. FEBS Lett. 2011 Feb 18;585(4):657-63.
REF 10 Modulation of ALDH5A1 and SLC22A7 by microRNA hsa-miR-29a-3p in human liver cells. Biochem Pharmacol. 2015 Dec 15;98(4):671-80.
REF 11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 12 Underexpression of CACNA1C Caused by Overexpression of microRNA-29a Underlies the Pathogenesis of Atrial Fibrillation. Med Sci Monit. 2016 Jun 24;22:2175-81.
REF 13 MicroRNA-29a contributes to drug-resistance of breast cancer cells to adriamycin through PTEN/AKT/GSK3 signaling pathway. Gene. 2016 Nov 15;593(1):84-90.
REF 14 MicroRNA-29B (mir-29b) regulates the Warburg effect in ovarian cancer by targeting AKT2 and AKT3. Oncotarget. 2015 Dec 1;6(38):40799-814.
REF 15 Involvement of miRNA-29a in epigenetic regulation of transforming growth factor--induced epithelial-mesenchymal transition in hepatocellular carcinoma. Hepatol Res. 2014 Aug;44(8):907-19.
REF 16 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 17 mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40.
REF 18 hTERT mediates gastric cancer metastasis partially through the indirect targeting of ITGB1 by microRNA-29a. Sci Rep. 2016 Feb 23;6:21955.
REF 19 The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23.
REF 20 MicroRNA-29a regulates the benzo[a]pyrene dihydrodiol epoxide-induced DNA damage response through Cdc7 kinase in lung cancer cells. Oncogenesis. 2013 Jul 22;2:e57.
REF 21 miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. J Biol Chem. 2010 Aug 13;285(33):25221-31.
REF 22 MicroRNA miR-29 modulates expression of immunoinhibitory molecule B7-H3: potential implications for immune based therapy of human solid tumors. Cancer Res. 2009 Aug 1;69(15):6275-81.
REF 23 Protective role of microRNA-29a in denatured dermis and skin fibroblast cells after thermal injury. Biol Open. 2016 Jan 21;5(3):211-9.
REF 24 Respiratory syncytial virus non-structural protein 1 facilitates virus replication through miR-29a-mediated inhibition of interferon- receptor. Biochem Biophys Res Commun. 2016 Sep 23;478(3):1436-41.
REF 25 Micro-RNAs miR-29a and miR-330-5p function as tumor suppressors by targeting the MUC1 mucin in pancreatic cancer cells. Biochim Biophys Acta. 2015 Oct;1853(10 Pt A):2392-403.
REF 26 Human cellular microRNA hsa-miR-29a interferes with viral nef protein expression and HIV-1 replication. Retrovirology. 2008 Dec 23;5:117.
REF 27 An androgen receptor-microrna-29a regulatory circuitry in mouse epididymis. J Biol Chem. 2013 Oct 11;288(41):29369-81.
REF 28 Progestin suppression of miR-29 potentiates dedifferentiation of breast cancer cells via KLF4. Oncogene. 2013 May 16;32(20):2555-64.
REF 29 MicroRNA-29a regulates intestinal membrane permeability in patients with irritable bowel syndrome. Gut. 2010 Jun;59(6):775-84.
REF 30 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 31 MiRNA-29a as a tumor suppressor mediates PRIMA-1Met-induced anti-myeloma activity by targeting c-Myc. Oncotarget. 2016 Feb 9;7(6):7149-60.
REF 32 The role, mechanism and potentially therapeutic application of microRNA-29 family in acute myeloid leukemia. Cell Death Differ. 2014 Jan;21(1):100-12.
REF 33 MiR-29a suppresses prostate cell proliferation and induces apoptosis via KDM5B protein regulation. Int J Clin Exp Med. 2015 Apr 15;8(4):5329-39.
REF 34 Regulation of human RNase-L by the miR-29 family reveals a novel oncogenic role in chronic myelogenous leukemia. J Interferon Cytokine Res. 2013 Jan;33(1):34-42.
REF 35 miR-29c targets TNFAIP3, inhibits cell proliferation and induces apoptosis in hepatitis B virus-related hepatocellular carcinoma. Biochem Biophys Res Commun. 2011 Aug 5;411(3):586-92.
REF 36 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 37 MicroRNA-29a suppresses the growth, migration, and invasion of lung adenocarcinoma cells by targeting carcinoembryonic antigen-related cell adhesion molecule 6. FEBS Lett. 2014 Oct 16;588(20):3744-50.
REF 38 microRNA expression alteration after arsenic trioxide treatment in HepG-2 cells. J Gastroenterol Hepatol. 2011 Jan;26(1):186-93.
REF 39 miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am J Respir Cell Mol Biol. 2011 Aug;45(2):287-94.
REF 40 Tumour-suppressive microRNA-29s inhibit cancer cell migration and invasion by targeting laminin-integrin signalling in head and neck squamous cell carcinoma. Br J Cancer. 2013 Nov 12;109(10):2636-45.
REF 41 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 42 Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303.
REF 43 MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8.
REF 44 miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am J Respir Cell Mol Biol. 2011 Aug;45(2):287-94.
REF 45 miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42.Nat Struct Mol Biol. 2009 Jan;16(1):23-9.
REF 46 Novel role of miR-29a in pancreatic cancer autophagy and its therapeutic potential.Oncotarget. 2016 Nov 1;7(44):71635-71650.
REF 47 Chronic lymphocytic leukemia modeled in mouse by targeted miR-29 expression.Proc Natl Acad Sci U S A. 2010 Jul 6;107(27):12210-5.
REF 48 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 49 miR-29a suppresses growth and migration of hepatocellular carcinoma by regulating CLDN1.Biochem Biophys Res Commun. 2017 May 6;486(3):732-737.
REF 50 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 51 High glucose down-regulates miR-29a to increase collagen IV production in HK-2 cells.FEBS Lett. 2010 Feb 19;584(4):811-6.
REF 52 A combined approach identifies three mRNAs that are down-regulated by microRNA-29b and promote invasion ability in the breast cancer cell line MCF-7. J Cancer Res Clin Oncol. 2012 Dec;138(12):2127-36.
REF 53 miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. J Biol Chem. 2013 Nov 15;288(46):33347-60.
REF 54 MicroRNA-29a and microRNA-142-3p are regulators of myeloid differentiation and acute myeloid leukemia. Blood. 2012 May 24;119(21):4992-5004.
REF 55 MicroRNA hsa-miR-29a-3p modulates CYP2C19 in human liver cells.Biochem Pharmacol. 2015 Nov 1;98(1):215-23.
REF 56 CPEB2, CPEB3 and CPEB4 are coordinately regulated by miRNAs recognizing conserved binding sites in paralog positions of their 3'-UTRs.Nucleic Acids Res. 2010 Nov;38(21):7698-710.
REF 57 ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer.BMC Cancer. 2015 Mar 4;15:93.
REF 58 Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.
REF 59 Epigenetic deregulation of miR-29a and miR-1256 by isoflavone contributes to the inhibition of prostate cancer cell growth and invasion.Epigenetics. 2012 Aug;7(8):940-9.
REF 60 MiR-29-mediated elastin down-regulation contributes to inorganic phosphorus-induced osteoblastic differentiation in vascular smooth muscle cells.Genes Cells. 2015 Dec;20(12):1077-87.
REF 61 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 62 FOXO3A regulation by miRNA-29a Controls chondrogenic differentiation of mesenchymal stem cells and cartilage formation.Stem Cells Dev. 2014 Jun 1;23(11):1195-205.
REF 63 miR-29 represses the activities of DNA methyltransferases and DNA demethylases.Int J Mol Sci. 2013 Jul 12;14(7):14647-58.
REF 64 Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506.
REF 65 MiRNA-29a regulates the expression of numerous proteins and reduces the invasiveness and proliferation of human carcinoma cell lines.Eur J Cancer. 2009 Nov;45(17):3104-18.
REF 66 Up-regulation of histone methyltransferase SETDB1 by multiple mechanisms in hepatocellular carcinoma promotes cancer metastasis.Hepatology. 2016 Feb;63(2):474-87.
REF 67 MiR-29a modulates the angiogenic properties of human endothelial cells.Biochem Biophys Res Commun. 2013 Apr 26;434(1):143-9.
REF 68 miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. J Biol Chem. 2010 Aug 13;285(33):25221-31.
REF 69 MicroRNA 29b functions in acute myeloid leukemia. Blood. 2009 Dec 17;114(26):5331-41.
REF 70 Ten-eleven translocation (Tet) and thymine DNA glycosylase (TDG), components of the demethylation pathway, are direct targets of miRNA-29a.Biochem Biophys Res Commun. 2013 Aug 2;437(3):368-73.
REF 71 microRNA-29 negatively regulates EMT regulator N-myc interactor in breast cancer.Mol Cancer. 2014 Aug 29;13:200.
REF 72 Aberrant microRNA expression in the brains of neurodegenerative diseases: miR-29a decreased in Alzheimer disease brains targets neurone navigator 3.Neuropathol Appl Neurobiol. 2010 Jun;36(4):320-30.
REF 73 Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96.
REF 74 miR-29a activates Hes1 by targeting Nfia in esophageal carcinoma cell line TE-1. Oncol Lett. 2015 Jan;9(1):96-102.
REF 75 MiR-29a/b/c regulate human circadian gene hPER1 expression by targeting its 3'UTR.Acta Biochim Biophys Sin (Shanghai). 2014 Apr;46(4):313-7.
REF 76 miR-29a levels are elevated in the db/db mice liver and its overexpression leads to attenuation of insulin action on PEPCK gene expression in HepG2 cells.Mol Cell Endocrinol. 2011 Jan 30;332(1-2):125-33.
REF 77 miR-29a promotes scavenger receptor A expression by targeting QKI (quaking) during monocyte-macrophage differentiation.Biochem Biophys Res Commun. 2015 Aug 14;464(1):1-6.
REF 78 Protective role of microRNA-29a in denatured dermis and skin fibroblast cells after thermal injury. Biol Open. 2016 Jan 21;5(3):211-9.
REF 79 MicroRNA-29a inhibits cell migration and invasion via targeting Roundabout homolog 1 in gastric cancer cells.Mol Med Rep. 2015 Sep;12(3):3944-3950.
REF 80 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 81 Tumor-suppressive microRNA-29a inhibits cancer cell migration and invasion via targeting HSP47 in cervical squamous cell carcinoma.Int J Oncol. 2013 Dec;43(6):1855-63.
REF 82 Modulation of ALDH5A1 and SLC22A7 by microRNA hsa-miR-29a-3p in human liver cells. Biochem Pharmacol. 2015 Dec 15;98(4):671-80.
REF 83 MiR-29a inhibits cell proliferation and induces cell cycle arrest through the downregulation of p42.3 in human gastric cancer.PLoS One. 2011;6(10):e25872.
REF 84 Tumor necrosis factor receptor associated factor-4: an adapter protein overexpressed in metastatic prostate cancer is regulated by microRNA-29a.Oncol Rep. 2013 Dec;30(6):2963-8.
REF 85 Identification of novel targets for miR-29a using miRNA proteomics.PLoS One. 2012;7(8):e43243.
REF 86 miR-29a inhibition normalizes HuR over-expression and aberrant AU-rich mRNA stability in invasive cancer.J Pathol. 2013 May;230(1):28-38.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.