miRNA General Information
miRNA Mature ID	hsa-miR-29b-3p
miRNA Stemloop AC	MI0000105 | MI0000107
miRNA Stemloop ID	hsa-mir-29b-1 | hsa-mir-29b-2
Sequence	uagcaccauuugaaaucaguguu
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[1]
	DNA [cytosine-5]-methyltransferase 3B (DNMT3B)	Clinical trial Target	Target Info	[2]
	Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)	Clinical trial Target	Target Info	[3]
	Beta-secretase 1 (BACE1)	Clinical trial Target	Target Info	[4]
	Transcription factor Sp1 (SP1)	Clinical trial Target	Target Info	[5]
	DNA [cytosine-5]-methyltransferase 3A (DNMT3A)	Patented-recorded Target	Target Info	[2]
	T-cell leukemia/lymphoma protein 1A (TCL1A)	Literature-reported Target	Target Info	[6]
Protein(s) Regulated by This miRNA	Apoptosis-stimulating of p53 protein 1	Regulated Protein	ASPP1_HUMAN	[7]
	Aquaporin-4	Regulated Protein	AQP4_HUMAN	[8]
	Beta-catenin-interacting protein 1	Regulated Protein	CNBP1_HUMAN	[9]
	Beta/gamma crystallin domain-containing protein 1	Regulated Protein	CRBG1_HUMAN	[10]
	Cell division control protein 42 homolog	Regulated Protein	CDC42_HUMAN	[7]
	Collagen alpha-1(I) chain	Regulated Protein	CO1A1_HUMAN	[11]
	Collagen alpha-1(III) chain	Regulated Protein	CO3A1_HUMAN	[12]
	Collagen alpha-1(IV) chain	Regulated Protein	CO4A1_HUMAN	[12]
	Collagen alpha-1(V) chain	Regulated Protein	CO5A1_HUMAN	[13]
	Collagen alpha-1(X) chain	Regulated Protein	COAA1_HUMAN	[14]
	Collagen alpha-1(XV) chain	Regulated Protein	COFA1_HUMAN	[13]
	Collagen alpha-2(IV) chain	Regulated Protein	CO4A2_HUMAN	[14]
	Collagen alpha-2(V) chain	Regulated Protein	CO5A2_HUMAN	[14]
	Collagen alpha-3(V) chain	Regulated Protein	CO5A3_HUMAN	[9]
	Desmocollin-2	Regulated Protein	DSC2_HUMAN	[10]
	Disintegrin and metalloproteinase domain-containing protein 12	Regulated Protein	ADA12_HUMAN	[15]
	DnaJ homolog subfamily B member 11	Regulated Protein	DJB11_HUMAN	[16]
	Dual specificity protein phosphatase 2	Regulated Protein	DUS2_HUMAN	[9]
	E3 ubiquitin-protein ligase AMFR	Regulated Protein	AMFR_HUMAN	[10]
	Epithelial membrane protein 1	Regulated Protein	EMP1_HUMAN	[10]
	Fibrillin-1	Regulated Protein	FBN1_HUMAN	[14]
	Fibrinogen alpha chain	Regulated Protein	FIBA_HUMAN	[17]
	Fibrinogen beta chain	Regulated Protein	FIBB_HUMAN	[17]
	G/T mismatch-specific thymine DNA glycosylase	Regulated Protein	TDG_HUMAN	[18]
	G1/S-specific cyclin-D2	Regulated Protein	CCND2_HUMAN	[19]
	Interleukin-32	Regulated Protein	IL32_HUMAN	[20]
	Kinesin-like protein KIF1B	Regulated Protein	KIF1B_HUMAN	[21]
	Laminin subunit alpha-2	Regulated Protein	LAMA2_HUMAN	[13]
	Laminin subunit gamma-1	Regulated Protein	LAMC1_HUMAN	[22]
	LIM and SH3 domain protein 1	Regulated Protein	LASP1_HUMAN	[22]
	Lysyl oxidase homolog 4	Regulated Protein	LOXL4_HUMAN	[23]
	Matrix metalloproteinase-24	Regulated Protein	MMP24_HUMAN	[24]
	Max dimerization protein 1	Regulated Protein	MAD1_HUMAN	[10]
	Menin	Regulated Protein	MEN1_HUMAN	[25]
	Methylcytosine dioxygenase TET1	Regulated Protein	TET1_HUMAN	[26]
	Methylcytosine dioxygenase TET1	Regulated Protein	TET1_HUMAN	[18]
	Methylcytosine dioxygenase TET1	Regulated Protein	TET1_HUMAN	[27]
	Methylcytosine dioxygenase TET2	Regulated Protein	TET2_HUMAN	[28]
	NF-kappa-B inhibitor-interacting Ras-like protein 2	Regulated Protein	KBRS2_HUMAN	[29]
	Nidogen-1	Regulated Protein	NID1_HUMAN	[15]
	Nuclear autoantigenic sperm protein	Regulated Protein	NASP_HUMAN	[30]
	Period circadian protein homolog 1	Regulated Protein	PER1_HUMAN	[31]
	Phosphatase and actin regulator 2	Regulated Protein	PHAR2_HUMAN	[10]
	Phosphatidylinositol 3-kinase regulatory subunit alpha	Regulated Protein	P85A_HUMAN	[32]
	Phosphatidylinositol 3-kinase regulatory subunit alpha	Regulated Protein	P85A_HUMAN	[33]
	POZ-, AT hook-, and zinc finger-containing protein 1	Regulated Protein	PATZ1_HUMAN	[34]
	Retinal homeobox protein Rx	Regulated Protein	RX_HUMAN	[35]
	Serine/threonine-protein kinase RIO3	Regulated Protein	RIOK3_HUMAN	[10]
	Serpin H1	Regulated Protein	SERPH_HUMAN	[14]
	Sorting nexin-24	Regulated Protein	SNX24_HUMAN	[10]
	Splicing factor, proline- and glutamine-rich	Regulated Protein	SFPQ_HUMAN	[16]
	Thrombospondin-2	Regulated Protein	TSP2_HUMAN	[13]
	Tubulin beta-2A chain	Regulated Protein	TBB2A_HUMAN	[10]
	WD repeat-containing protein 26	Regulated Protein	WDR26_HUMAN	[10]
	Zinc finger protein SNAI3	Regulated Protein	SNAI3_HUMAN	[36]
References
REF 1	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 2	MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 3	mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40.
REF 4	The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23.
REF 5	The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res. 2007 Nov 15;67(22):11001-11.
REF 6	Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res. 2006 Dec 15;66(24):11590-3.
REF 7	miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42.Nat Struct Mol Biol. 2009 Jan;16(1):23-9.
REF 8	MicroRNA-29b is a therapeutic target in cerebral ischemia associated with aquaporin 4.J Cereb Blood Flow Metab. 2015 Dec;35(12):1977-84.
REF 9	Peptide-mediated intracellular delivery of miRNA-29b for osteogenic stem cell differentiation.Biomaterials. 2013 Jun;34(17):4347-59.
REF 10	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 11	Suppression of type I collagen production by microRNA-29b in cultured human stellate cells. Biochem Biophys Res Commun. 2010 Jan 1;391(1):316-21.
REF 12	MBP-1 upregulates miR-29b that represses Mcl-1, collagens, and matrix-metalloproteinase-2 in prostate cancer cells.Genes Cancer. 2010 Apr 1;1(4):381-387.
REF 13	Chaperone Hsp47 Drives Malignant Growth and Invasion by Modulating an ECM Gene Network.Cancer Res. 2015 Apr 15;75(8):1580-91.
REF 14	A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 15	miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am J Respir Cell Mol Biol. 2011 Aug;45(2):287-94.
REF 16	Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.
REF 17	Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 18	miR-29 represses the activities of DNA methyltransferases and DNA demethylases.Int J Mol Sci. 2013 Jul 12;14(7):14647-58.
REF 19	Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506.
REF 20	Inducible interleukin 32 (IL-32) exerts extensive antiviral function via selective stimulation of interferon 1 (IFN-1).J Biol Chem. 2013 Jul 19;288(29):20927-41.
REF 21	Expression and functional role of miR-29b in renal cell carcinoma. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14161-70.
REF 22	Systems analysis identifies miR-29b regulation of invasiveness in melanoma.Mol Cancer. 2016 Nov 16;15(1):72.
REF 23	GATA3 suppresses metastasis and modulates the tumour microenvironment by regulating microRNA-29b expression.Nat Cell Biol. 2013 Feb;15(2):201-13.
REF 24	MicroRNAs profiling in murine models of acute and chronic asthma: a relationship with mRNAs targets. PLoS One. 2011 Jan 28;6(1):e16509.
REF 25	Modulation by miR-29b of intestinal epithelium homoeostasis through the repression of menin translation.Biochem J. 2015 Jan 15;465(2):315-23.
REF 26	MicroRNA 29b functions in acute myeloid leukemia. Blood. 2009 Dec 17;114(26):5331-41.
REF 27	Enhanced MAPK signaling drives ETS1-mediated induction of miR-29b leading to downregulation of TET1 and changes in epigenetic modifications in a subset of lung SCC.Oncogene. 2016 Aug 18;35(33):4345-57.
REF 28	An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013 Oct 31;5(2):471-81.
REF 29	Role of miR-29b on the regulation of the extracellular matrix in human trabecular meshwork cells under chronic oxidative stress.Mol Vis. 2009 Nov 28;15:2488-97.
REF 30	Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012 Mar;40(5):2181-96.
REF 31	MiR-29a/b/c regulate human circadian gene hPER1 expression by targeting its 3'UTR.Acta Biochim Biophys Sin (Shanghai). 2014 Apr;46(4):313-7.
REF 32	miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623.
REF 33	microRNA-29b prevents liver fibrosis by attenuating hepatic stellate cell activation and inducing apoptosis through targeting PI3K/AKT pathway.Oncotarget. 2015 Mar 30;6(9):7325-38.
REF 34	PATZ1 is a target of miR-29b that is induced by Ha-Ras oncogene in rat thyroid cells.Sci Rep. 2016 Apr 29;6:25268.
REF 35	Expression and cellular localization of microRNA-29b and RAX, an activator of the RNA-dependent protein kinase (PKR), in the retina of streptozotocin-induced diabetic rats.Mol Vis. 2011;17:2228-40.
REF 36	miRNA-29b suppresses prostate cancer metastasis by regulating epithelial-mesenchymal transition signaling.Mol Cancer Ther. 2012 May;11(5):1166-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.