miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-302a-5p | ||||
| miRNA Stemloop AC | MI0000738 | ||||
| miRNA Stemloop ID | hsa-mir-302a | ||||
| Sequence | acuuaaacguggauguacuugcu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| References | |||||
| REF 1 | Up-regulation of microRNA-302a inhibited the proliferation and invasion of colorectal cancer cells by regulation of the MAPK and PI3K/Akt signaling... Int J Clin Exp Pathol. 2015 May 1;8(5):4481-91. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.