miRNA General Information
miRNA Mature ID hsa-miR-302b-3p
miRNA Stemloop AC MI0000772
miRNA Stemloop ID hsa-mir-302b
Sequence uaagugcuuccauguuuuaguag
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Erbb4 tyrosine kinase receptor (Erbb-4) Successful Target Target Info [2]
Dihydrothymine dehydrogenase (DPYD) Successful Target Target Info [3]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [4]
Cyclin-dependent kinase 2 (CDK2) Clinical trial Target Target Info [5]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [6]
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Clinical trial Target Target Info [3]
MAPK/ERK kinase kinase 1 (MAP3K1) Clinical trial Target Target Info [7]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [8]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [9]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [10]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [11]
Protein(s) Regulated by This miRNA G1/S-specific cyclin-D2 Regulated Protein [12]
Nuclear factor 1 A-type Regulated Protein [13]
Rho-related GTP-binding protein RhoC Regulated Protein [8]
References
REF 1 MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer. 2013 Oct 2;13:448.
REF 2 miR-302b is a potential molecular marker of esophageal squamous cell carcinoma and functions as a tumor suppressor by targeting ErbB4. J Exp Clin Cancer Res. 2014 Jan 19;33:10.
REF 3 MicroRNA-302b Enhances the Sensitivity of Hepatocellular Carcinoma Cell Lines to 5-FU via Targeting Mcl-1 and DPYD. Int J Mol Sci. 2015 Oct 6;16(10):23668-82.
REF 4 The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95.
REF 5 miR-302b regulates cell cycles by targeting CDK2 via ERK signaling pathway in gastric cancer. Cancer Med. 2016 Sep;5(9):2302-13.
REF 6 Increased sensitivity to chemotherapy induced by CpG-ODN treatment is mediated by microRNA modulation. PLoS One. 2013;8(3):e58849.
REF 7 MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25.
REF 8 Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8.
REF 9 miR-302b enhances breast cancer cell sensitivity to cisplatin by regulating E2F1 and the cellular DNA damage response. Oncotarget. 2016 Jan 5;7(1):786-97.
REF 10 miRNA-302b suppresses human hepatocellular carcinoma by targeting AKT2. Mol Cancer Res. 2014 Feb;12(2):190-202.
REF 11 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 12 miR-302b maintains "stemness" of human embryonal carcinoma cells by post-transcriptional regulation of Cyclin D2 expression.Biochem Biophys Res Commun. 2008 Dec 12;377(2):434-440.
REF 13 The microRNA-302b-inhibited insulin-like growth factor-binding protein 2 signaling pathway induces glioma cell apoptosis by targeting nuclear factor IA.PLoS One. 2017 Mar 21;12(3):e0173890.
REF 14 Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.