miRNA General Information
miRNA Mature ID hsa-miR-302c-3p
miRNA Stemloop AC MI0000773
miRNA Stemloop ID hsa-mir-302c
Sequence uaagugcuuccauguuucagugg
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Interleukin-8 (IL8) Successful Target Target Info [2]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [3]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [4]
MAPK/ERK kinase kinase 1 (MAP3K1) Clinical trial Target Target Info [5]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [6]
Metastasis adhesion protein (MTDH) Literature-reported Target Target Info [7]
Protein(s) Regulated by This miRNA GRB2-associated-binding protein 2 Regulated Protein [8]
MHC class I polypeptide-related sequence A Regulated Protein [9]
References
REF 1 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2 Loss of RACK1 Promotes Metastasis of Gastric Cancer by Inducing a miR-302c/IL8 Signaling Loop. Cancer Res. 2015 Sep 15;75(18):3832-41.
REF 3 The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95.
REF 4 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 5 MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25.
REF 6 Inhibition of microRNA-302 (miR-302) by bone morphogenetic protein 4 (BMP4) facilitates the BMP signaling pathway. J Biol Chem. 2012 Nov 9;287(46):38656-64.
REF 7 MiR-302c-3p suppresses invasion and proliferation of glioma cells via down-regulating metadherin (MTDH) expression. Cancer Biol Ther. 2015;16(9):1308-15.
REF 8 microRNA-302c-3p inhibits renal cell carcinoma cell proliferation by targeting Grb2-associated binding 2 (Gab2).Oncotarget. 2017 Apr 18;8(16):26334-26343.
REF 9 Downregulation of miR-302c and miR-520c by 1,25(OH)2D3 treatment enhances the susceptibility of tumour cells to natural killer cell-mediated cytotoxicity.Br J Cancer. 2013 Aug 6;109(3):723-30.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.