miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-302d-3p | ||||
| miRNA Stemloop AC | MI0000774 | ||||
| miRNA Stemloop ID | hsa-mir-302d | ||||
| Sequence | uaagugcuuccauguuugagugu | ||||
| TTD Target(s) Regulated by This miRNA | Erbb4 tyrosine kinase receptor (Erbb-4) | Successful Target | Target Info | [1] | |
| Interleukin-8 (IL8) | Successful Target | Target Info | [2] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [4] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [5] | ||
| MAPK/ERK kinase kinase 1 (MAP3K1) | Clinical trial Target | Target Info | [6] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [7] | ||
| Orphan nuclear receptor NURR1 (NR4A2) | Literature-reported Target | Target Info | [1] | ||
| Muscleblind-like protein 1 (MBNL2) | Literature-reported Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | G1/S-specific cyclin-D2 | Regulated Protein | [9] | ||
| Interferon regulatory factor 9 | Regulated Protein | [10] | |||
| Krueppel-like factor 13 | Regulated Protein | [8] | |||
| Left-right determination factor 1 | Regulated Protein | [12] | |||
| Left-right determination factor 2 | Regulated Protein | [12] | |||
| Zinc finger transcription factor Trps1 | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102. | ||||
| REF 2 | Loss of RACK1 Promotes Metastasis of Gastric Cancer by Inducing a miR-302c/IL8 Signaling Loop. Cancer Res. 2015 Sep 15;75(18):3832-41. | ||||
| REF 3 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 4 | The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95. | ||||
| REF 5 | Global microRNA characterization reveals that miR-103 is involved in IGF-1 stimulated mouse intestinal cell proliferation. PLoS One. 2010 Sep 23;5(9):e12976. | ||||
| REF 6 | MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. | ||||
| REF 7 | MicroRNA-302d downregulates TGFBR2 expression and promotes hepatocellular carcinoma growth and invasion. Exp Ther Med. 2017 Feb;13(2):681-687. | ||||
| REF 8 | Target identification of microRNAs expressed highly in human embryonic stem cells. J Cell Biochem. 2009 Apr 15;106(6):1020-30. | ||||
| REF 9 | MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. Cancer Res. 2010 Nov 15;70(22):9473-82. | ||||
| REF 10 | MicroRNA-302d targets IRF9 to regulate the IFN-induced gene expression in SLE.J Autoimmun. 2017 May;79:105-111. | ||||
| REF 11 | Target identification of microRNAs expressed highly in human embryonic stem cells. J Cell Biochem. 2009 Apr 15;106(6):1020-30. | ||||
| REF 12 | The Nodal inhibitor Lefty is negatively modulated by the microRNA miR-302 in human embryonic stem cells.FASEB J. 2011 May;25(5):1497-508. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.