miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30a-3p | ||||
| miRNA Stemloop AC | MI0000088 | ||||
| miRNA Stemloop ID | hsa-mir-30a | ||||
| Sequence | cuuucagucggauguuugcagc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [2] | ||
| Thrombospondin-1 (THBS1) | Clinical trial Target | Target Info | [1] | ||
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [3] | ||
| Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) | Literature-reported Target | Target Info | [4] | ||
| Cysteine-rich angiogenic inducer 61 (CYR61) | Literature-reported Target | Target Info | [1] | ||
| Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [5] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Cell surface hyaluronidase | Regulated Protein | [1] | ||
| Keratin, type II cytoskeletal 7 | Regulated Protein | [8] | |||
| Nuclear factor of activated T-cells, cytoplasmic 3 | Regulated Protein | [9] | |||
| Tubulin alpha-1A chain | Regulated Protein | [1] | |||
| Vezatin | Regulated Protein | [1] | |||
| WD repeat-containing protein 82 | Regulated Protein | [1] | |||
| X-box-binding protein 1 | Regulated Protein | [10] | |||
| Y+L amino acid transporter 2 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 2 | A microRNA-mediated regulatory loop modulates NOTCH and MYC oncogenic signals in B- and T-cell malignancies. Leukemia. 2015 Apr;29(4):968-76. | ||||
| REF 3 | MiRNA-30a-mediated autophagy inhibition sensitizes renal cell carcinoma cells to sorafenib. Biochem Biophys Res Commun. 2015 Apr 3;459(2):234-239. | ||||
| REF 4 | miRNA expression pattern associated with prognosis in elderly patients with advanced OPSC and OCC. Int J Oncol. 2013 Sep;43(3):839-49. | ||||
| REF 5 | MicroRNA-mediated epigenetic silencing of sirtuin1 contributes to impaired angiogenic responses. Circ Res. 2013 Sep 27;113(8):997-1003. | ||||
| REF 6 | The overexpression of miR-30a affects cell proliferation of chondrosarcoma via targeting Runx2. Tumour Biol. 2016 May;37(5):5933-40. | ||||
| REF 7 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 8 | Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52. | ||||
| REF 9 | MiR-30a Inhibits the Epithelial--Mesenchymal Transition of Podocytes through Downregulation of NFATc3.Int J Mol Sci. 2015 Oct 12;16(10):24032-47. | ||||
| REF 10 | MicroRNA regulation of unfolded protein response transcription factor XBP1 in the progression of cardiac hypertrophy and heart failure in vivo.J Transl Med. 2015 Nov 16;13:363. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.