miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30c-2-3p | ||||
| miRNA Stemloop AC | MI0000254 | ||||
| miRNA Stemloop ID | hsa-mir-30c-2 | ||||
| Sequence | cugggagaaggcuguuuacucu | ||||
| TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [1] | |
| Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | B-cell CLL/lymphoma 9 protein | Regulated Protein | [3] | ||
| Tumor necrosis factor receptor type 1-associated DEATH domain protein | Regulated Protein | [1] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | MicroRNA-30c-2-3p negatively regulates NF-B signaling and cell cycle progression through downregulation of TRADD and CCNE1 in breast cancer. Mol Oncol. 2015 Jun;9(6):1106-19. | ||||
| REF 2 | Lysophosphatidic Acid Mediates Activating Transcription Factor 3 Expression Which Is a Target for Post-Transcriptional Silencing by miR-30c-2-3p. PLoS One. 2015 Sep 29;10(9):e0139489. | ||||
| REF 3 | MicroRNA-30c-2* expressed in ovarian cancer cells suppresses growth factor-induced cellular proliferation and downregulates the oncogene BCL9.Mol Cancer Res. 2011 Dec;9(12):1732-45. | ||||
| REF 4 | MicroRNA-30c-2-3p negatively regulates NF-B signaling and cell cycle progression through downregulation of TRADD and CCNE1 in breast cancer. Mol Oncol. 2015 Jun;9(6):1106-19. | ||||
| REF 5 | MiR-30c protects diabetic nephropathy by suppressing epithelial-to-mesenchymal transition in db/db mice.Aging Cell. 2017 Apr;16(2):387-400. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.