miRNA General Information
miRNA Mature ID	hsa-miR-3188
miRNA Stemloop AC	MI0014232
miRNA Stemloop ID	hsa-mir-3188
Sequence	agaggcuuugugcggauacgggg
TTD Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Successful Target	Target Info	[1]
References
REF 1	miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 2016 Apr 20;7:11309.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.