miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-32-5p
miRNA Stemloop AC MI0000090
miRNA Stemloop ID hsa-mir-32
Sequence uauugcacauuacuaaguugca
TTD Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Clinical trial Target Target Info [1]
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Clinical trial Target Target Info [2]
Protein arginine methyltransferase 5 (PRMT5) Clinical trial Target Target Info [3]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [4]
Histone acetyltransferase KAT2B (KAT2B) Literature-reported Target Target Info [5]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [6]
F-box and WD-40 domain protein 7 (Fbxw7) Literature-reported Target Target Info [7]
Protein(s) Regulated by This miRNA Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[8]
DNA polymerase zeta catalytic subunit Regulated Protein
REV3L_HUMAN
[9]
Hamartin Regulated Protein
TSC1_HUMAN
[2]
PH domain leucine-rich repeat-containing protein phosphatase 2 Regulated Protein
PHLP2_HUMAN
[11]
Protein BTG2 Regulated Protein
BTG2_HUMAN
[12]
Regulator of G-protein signaling 17 Regulated Protein
RGS17_HUMAN
[13]
Solute carrier family 45 member 3 Regulated Protein
S45A3_HUMAN
[14]
TNF receptor-associated factor 3 Regulated Protein
TRAF3_HUMAN
[15]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[16]
References
REF 1 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 2 MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5316-21.
REF 3 Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol Cell Biol. 2008 Oct;28(20):6262-77.
REF 4 MiR-32 promotes gastric carcinoma tumorigenesis by targeting Kruppel-like factor 4. Biochem Biophys Res Commun. 2015 Nov 27;467(4):913-20.
REF 5 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 6 Downregulated microRNA-32 expression induced by high glucose inhibits cell cycle progression via PTEN upregulation and Akt inactivation in bone marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun. 2013 Apr 19;433(4):526-31.
REF 7 MicroRNA-32 promotes cell proliferation, migration and suppresses apoptosis in breast cancer cells by targeting FBXW7. Cancer Cell Int. 2017 Jan 25;17:14.
REF 8 Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Res. 2008 Aug 1;68(15):6162-70.
REF 9 REV3L 3'UTR 460 T>C polymorphism in microRNA target sites contributes to lung cancer susceptibility.Oncogene. 2013 Jan 10;32(2):242-50.
REF 10 MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5316-21.
REF 11 MiR-32 contributed to cell proliferation of human breast cancer cells by suppressing of PHLPP2 expression.Biomed Pharmacother. 2015 Oct;75:105-10.
REF 12 SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes.Nat Commun. 2015 Sep 23;6:8257.
REF 13 Deregulation of RGS17 Expression Promotes Breast Cancer Progression.J Cancer. 2015 Jul 3;6(8):767-75.
REF 14 miR-32 and its target SLC45A3 regulate the lipid metabolism of oligodendrocytes and myelin.Neuroscience. 2012 Jun 28;213:29-37.
REF 15 HIV-1 Tat C-mediated regulation of tumor necrosis factor receptor-associated factor-3 by microRNA 32 in human microglia.J Neuroinflammation. 2012 Jun 18;9:131.
REF 16 miR-32 inhibits proliferation, epithelial-mesenchymal transition, and metastasis by targeting TWIST1 in non-small-cell lung cancer cells.Onco Targets Ther. 2016 Mar 14;9:1489-98.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.