miRNA General Information
miRNA Mature ID	hsa-miR-320a-3p
miRNA Stemloop AC	MI0000542
miRNA Stemloop ID	hsa-mir-320a
Sequence	aaaagcuggguugagagggcga
TTD Target(s) Regulated by This miRNA	Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)	Clinical trial Target	Target Info	[1]
References
REF 1	mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.