miRNA General Information
miRNA Mature ID	hsa-miR-323b-5p
miRNA Stemloop AC	MI0014206
miRNA Stemloop ID	hsa-mir-323b
Sequence	agguuguccguggugaguucgca
TTD Target(s) Regulated by This miRNA	Erbb2 tyrosine kinase receptor (HER2)	Successful Target	Target Info	[1]
References
REF 1	High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.