miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-324-5p | ||||
| miRNA Stemloop AC | MI0000813 | ||||
| miRNA Stemloop ID | hsa-mir-324 | ||||
| Sequence | cgcauccccuagggcauuggug | ||||
| miRNA General Information | |||||
| miRNA Mature ID | hsa-miR-324-5p | ||||
| miRNA Stemloop AC | MI0000813 | ||||
| miRNA Stemloop ID | hsa-mir-324 | ||||
| Sequence | cgcauccccuagggcauuggugu | ||||
| TTD Target(s) Regulated by This miRNA | Smoothened homolog (SMO) | Successful Target | Target Info | [1] | |
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [3] | ||
| Zinc finger protein GLI1 (Gli1) | Patented-recorded Target | Target Info | [1] | ||
| Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Mitochondrial fission regulator 1 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | Concerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. EMBO J. 2008 Oct 8;27(19):2616-27. | ||||
| REF 2 | Mycobacteria-responsive sonic hedgehog signaling mediates programmed death-ligand 1- and prostaglandin E2-induced regulatory T cell expansion. Sci Rep. 2016 Apr 15;6:24193. | ||||
| REF 3 | MiR-324-5p Suppresses Hepatocellular Carcinoma Cell Invasion by Counteracting ECM Degradation through Post-Transcriptionally Downregulating ETS1 and SP1. PLoS One. 2015 Jul 15;10(7):e0133074. | ||||
| REF 4 | NFAT4-dependent miR-324-5p regulates mitochondrial morphology and cardiomyocyte cell death by targeting Mtfr1.Cell Death Dis. 2015 Dec 3;6:e2007. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.