miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-326 | ||||
| miRNA Stemloop AC | MI0000808 | ||||
| miRNA Stemloop ID | hsa-mir-326 | ||||
| Sequence | ccucugggcccuuccuccag | ||||
| TTD Target(s) Regulated by This miRNA | Smoothened homolog (SMO) | Successful Target | Target Info | [1] | |
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [3] | ||
| Heparin-binding growth factor 1 (FGF1) | Clinical trial Target | Target Info | [4] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [5] | ||
| Notch-2 receptor (NOTCH2) | Clinical trial Target | Target Info | [5] | ||
| Pyruvate kinase M2 (PKM) | Clinical trial Target | Target Info | [6] | ||
| Fascin (FSCN1) | Clinical trial Target | Target Info | [7] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [8] | ||
| Zinc finger protein GLI1 (Gli1) | Patented-recorded Target | Target Info | [1] | ||
| Leukocyte antigen MIC3 (CD9) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | DNA mismatch repair protein Msh3 | Regulated Protein | [9] | ||
| RNA-binding protein NOB1 | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | Concerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. EMBO J. 2008 Oct 8;27(19):2616-27. | ||||
| REF 2 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 3 | miR-326 targets antiapoptotic Bcl-xL and mediates apoptosis in human platelets. PLoS One. 2015 Apr 13;10(4):e0122784. | ||||
| REF 4 | Knockdown of long non-coding RNA HOTAIR inhibits malignant biological behaviors of human glioma cells via modulation of miR-326. Oncotarget. 2015 Sep 8;6(26):21934-49. | ||||
| REF 5 | The neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumors. J Neurosci. 2009 Dec 2;29(48):15161-8. | ||||
| REF 6 | Pyruvate kinase M2 is a target of the tumor-suppressive microRNA-326 and regulates the survival of glioma cells. Neuro Oncol. 2010 Nov;12(11):1102-12. | ||||
| REF 7 | Down-regulation of miR-326 is associated with poor prognosis and promotes growth and metastasis by targeting FSCN1 in gastric cancer. Growth Factors. 2015;33(4):267-74. | ||||
| REF 8 | miR-326 reverses chemoresistance in human lung adenocarcinoma cells by targeting specificity protein 1. Tumour Biol. 2016 Oct;37(10):13287-13294. | ||||
| REF 9 | Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. | ||||
| REF 10 | Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. | ||||
| REF 11 | MicroRNA-326 functions as a tumor suppressor in glioma by targeting the Nin one binding protein (NOB1).PLoS One. 2013 Jul 15;8(7):e68469. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.