miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-328-3p | ||||
| miRNA Stemloop AC | MI0000804 | ||||
| miRNA Stemloop ID | hsa-mir-328 | ||||
| Sequence | cuggcccucucugcccuuccgu | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [1] | |
| Voltage-gated potassium channel Kv11.1 (KCNH2) | Successful Target | Target Info | [2] | ||
| Beta-secretase 1 (BACE1) | Clinical trial Target | Target Info | [3] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [4] | ||
| FK506-binding protein 4 (FKBP4) | Literature-reported Target | Target Info | [5] | ||
| Matrix metalloproteinase-16 (MMP-16) | Literature-reported Target | Target Info | [6] | ||
| Protein-tyrosine phosphatase eta (HPTP) | Patented-recorded Target | Target Info | [7] | ||
| Gamma-Histone H2AX (H2AFX) | Literature-reported Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 | Regulated Protein | [9] | ||
| Secreted frizzled-related protein 1 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008 Jun 1;104(3):805-17. | ||||
| REF 2 | Arsenic trioxide inhibits breast cancer cell growth via microRNA-328/hERG pathway in MCF-7 cells. Mol Med Rep. 2015 Jul;12(1):1233-8. | ||||
| REF 3 | MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35. | ||||
| REF 4 | The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10. | ||||
| REF 5 | Transcriptomic profiling of platelet senescence and platelet extracellular vesicles. Transfusion. 2017 Jan;57(1):144-156. | ||||
| REF 6 | MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30. | ||||
| REF 7 | Protein tyrosine phosphatase PTPRJ is negatively regulated by microRNA-328. FEBS J. 2013 Jan;280(2):401-12. | ||||
| REF 8 | miR-24-mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells. Nat Struct Mol Biol. 2009 May;16(5):492-8. | ||||
| REF 9 | MiR-328 suppresses the survival of esophageal cancer cells by targeting PLCE1.Biochem Biophys Res Commun. 2016 Jan 29;470(1):175-180. | ||||
| REF 10 | MiR-328 promotes glioma cell invasion via SFRP1-dependent Wnt-signaling activation.Neuro Oncol. 2014 Jan;16(2):179-90. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.