miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-330-3p | ||||
| miRNA Stemloop AC | MI0000803 | ||||
| miRNA Stemloop ID | hsa-mir-330 | ||||
| Sequence | gcaaagcacacggccugcagaga | ||||
| TTD Target(s) Regulated by This miRNA | NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [3] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [4] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [5] | ||
| RNA-binding protein Musashi-1 (MSI1) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Cell division control protein 42 homolog | Regulated Protein | [4] | ||
| Collagen and calcium-binding EGF domain-containing protein 1 | Regulated Protein | [8] | |||
| E3 SUMO-protein ligase EGR2 | Regulated Protein | [9] | |||
| Endophilin-A1 | Regulated Protein | [10] | |||
| Programmed cell death protein 4 | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71. | ||||
| REF 2 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 3 | c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43. | ||||
| REF 4 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 5 | microRNA-330 inhibits cell motility by downregulating Sp1 in prostate cancer cells. Oncol Rep. 2013 Jul;30(1):327-33. | ||||
| REF 6 | MiR-330-3p inhibits gastric cancer progression through targeting MSI1. Am J Transl Res. 2016 Nov 15;8(11):4802-4811. | ||||
| REF 7 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 8 | Targeting of CCBE1 by miR-330-3p in human breast cancer promotes metastasis.Br J Cancer. 2017 May 9;116(10):1350-1357. | ||||
| REF 9 | miR-330-3p controls cell proliferation by targeting early growth response 2 in non-small-cell lung cancer.Acta Biochim Biophys Sin (Shanghai). 2015 Jun;47(6):431-40. | ||||
| REF 10 | MicroRNA-330 is an oncogenic factor in glioblastoma cells by regulating SH3GL2 gene.PLoS One. 2012;7(9):e46010. | ||||
| REF 11 | MicroRNA-330-3p functions as an oncogene in human esophageal cancer by targeting programmed cell death 4. Am J Cancer Res. 2015 Feb 15;5(3):1062-75. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.