miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-331-3p | ||||
| miRNA Stemloop AC | MI0000812 | ||||
| miRNA Stemloop ID | hsa-mir-331 | ||||
| Sequence | gccccugggccuauccuagaa | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Fragile histidine triad protein (FHIT) | Successful Target | Target Info | [2] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [3] | ||
| Neuropilin-2 (NRP2) | Clinical trial Target | Target Info | [4] | ||
| Nucleus accumbens-associated protein 1 (NACC1) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Deoxyhypusine hydroxylase | Regulated Protein | [6] | ||
| Inhibitor of growth protein 5 | Regulated Protein | [7] | |||
| PH domain leucine-rich repeat-containing protein phosphatase 1 | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86. | ||||
| REF 2 | microRNA-143 protects cells from DNA damage-induced killing by downregulating FHIT expression. Cancer Biother Radiopharm. 2011 Jun;26(3):365-72. | ||||
| REF 3 | miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer. Biochem Biophys Res Commun. 2010 Jul 16;398(1):1-6. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | Syndecan-1 up-regulates microRNA-331-3p and mediates epithelial-to-mesenchymal transition in prostate cancer. Mol Carcinog. 2016 Sep;55(9):1378-86. | ||||
| REF 6 | Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells.J Biol Chem. 2012 Oct 12;287(42):35251-9. | ||||
| REF 7 | Upregulated in Hepatitis B virus-associated hepatocellular carcinoma cells, miR-331-3p promotes proliferation of hepatocellular carcinoma cells by targeting ING5.Oncotarget. 2015 Nov 10;6(35):38093-106. | ||||
| REF 8 | MicroRNA-331-3p promotes proliferation and metastasis of hepatocellular carcinoma by targeting PH domain and leucine-rich repeat protein phosphatase.Hepatology. 2014 Oct;60(4):1251-63. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.