miRNA General Information
miRNA Mature ID hsa-miR-331-3p
miRNA Stemloop AC MI0000812
miRNA Stemloop ID hsa-mir-331
Sequence gccccugggccuauccuagaa
TTD Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [1]
Fragile histidine triad protein (FHIT) Successful Target Target Info [2]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [3]
Neuropilin-2 (NRP2) Literature-reported Target Target Info [4]
Nucleus accumbens-associated protein 1 (NACC1) Literature-reported Target Target Info [5]
Protein(s) Regulated by This miRNA Deoxyhypusine hydroxylase Regulated Protein [6]
Inhibitor of growth protein 5 Regulated Protein [7]
PH domain leucine-rich repeat-containing protein phosphatase 1 Regulated Protein [8]
References
REF 1 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 2 microRNA-143 protects cells from DNA damage-induced killing by downregulating FHIT expression. Cancer Biother Radiopharm. 2011 Jun;26(3):365-72.
REF 3 miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer. Biochem Biophys Res Commun. 2010 Jul 16;398(1):1-6.
REF 4 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 5 Syndecan-1 up-regulates microRNA-331-3p and mediates epithelial-to-mesenchymal transition in prostate cancer. Mol Carcinog. 2016 Sep;55(9):1378-86.
REF 6 Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells.J Biol Chem. 2012 Oct 12;287(42):35251-9.
REF 7 Upregulated in Hepatitis B virus-associated hepatocellular carcinoma cells, miR-331-3p promotes proliferation of hepatocellular carcinoma cells by targeting ING5.Oncotarget. 2015 Nov 10;6(35):38093-106.
REF 8 MicroRNA-331-3p promotes proliferation and metastasis of hepatocellular carcinoma by targeting PH domain and leucine-rich repeat protein phosphatase.Hepatology. 2014 Oct;60(4):1251-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.