miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-338-3p | ||||
| miRNA Stemloop AC | MI0000814 | ||||
| miRNA Stemloop ID | hsa-mir-338 | ||||
| Sequence | uccagcaucagugauuuuguug | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Smoothened homolog (SMO) | Successful Target | Target Info | [2] | ||
| Neuropilin-1 (NRP1) | Successful Target | Target Info | [3] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| TNF alpha converting enzyme (ADAM17) | Clinical trial Target | Target Info | [4] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [5] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [6] | ||
| Neural cadherin (CDH2) | Clinical trial Target | Target Info | [7] | ||
| Pyruvate kinase M2 (PKM) | Clinical trial Target | Target Info | [8] | ||
| Integrin beta-3 (ITGB3) | Literature-reported Target | Target Info | [9] | ||
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [10] | ||
| SSX2-interacting protein (SSX2IP) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | Cytosolic phospholipase A2 beta | Regulated Protein | [12] | ||
| Disabled homolog 2-interacting protein | Regulated Protein | [13] | |||
| Insulin receptor substrate 2 | Regulated Protein | [14] | |||
| Metastasis-associated in colon cancer protein 1 | Regulated Protein | [10] | |||
| Microtubule-associated protein 1A | Regulated Protein | [13] | |||
| Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 2 protein | Regulated Protein | [16] | |||
| Pyruvate kinase PKLR | Regulated Protein | [17] | |||
| RNA-binding protein Nova-1 | Regulated Protein | [13] | |||
| Tafazzin | Regulated Protein | [18] | |||
| Transcription factor SOX-4 | Regulated Protein | [19] | |||
| Ubiquitin-conjugating enzyme E2 Q1 | Regulated Protein | [13] | |||
| Zinc finger and BTB domain-containing protein 18 | Regulated Protein | [13] | |||
| References | |||||
| REF 1 | miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72. | ||||
| REF 2 | miRNA-338-3p suppresses cell growth of human colorectal carcinoma by targeting smoothened. World J Gastroenterol. 2013;19(14):2197-207. | ||||
| REF 3 | MicroRNA-338 inhibits growth, invasion and metastasis of gastric cancer by targeting NRP1 expression. PLoS One. 2014 Apr 15;9(4):e94422. | ||||
| REF 4 | MiR-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10922-8. | ||||
| REF 5 | The effect of miR-338-3p on HBx deletion-mutant (HBx-d382) mediated liver-cell proliferation through CyclinD1 regulation. PLoS One. 2012;7(8):e43204. | ||||
| REF 6 | MicroRNA-338 inhibits migration and proliferation by targeting hypoxia-induced factor 1 in nasopharyngeal carcinoma. Oncol Rep. 2015 Oct;34(4):1943-52. | ||||
| REF 7 | J Biol Chem. 2016 Aug 19;291(34):17897-906. | ||||
| REF 8 | MiR-338-3p targets pyruvate kinase M2 and affects cell proliferation and metabolism of ovarian cancer. Am J Transl Res. 2016 Jul 15;8(7):3266-73. | ||||
| REF 9 | miR-338 inhibits the metastasis of lung cancer by targeting integrin 3. Oncol Rep. 2016 Sep;36(3):1467-74. | ||||
| REF 10 | MiR-338-3p inhibits epithelial-mesenchymal transition in gastric cancer cells by targeting ZEB2 and MACC1/Met/Akt signaling. Oncotarget. 2015 Jun 20;6(17):15222-34. | ||||
| REF 11 | Epigenetic silencing of miR-338-3p contributes to tumorigenicity in gastric cancer by targeting SSX2IP. PLoS One. 2013 Jun 24;8(6):e66782. | ||||
| REF 12 | Expression patterns of microRNAs in the chorioamniotic membranes: a role for microRNAs in human pregnancy and parturition.J Pathol. 2009 Jan;217(1):113-21. | ||||
| REF 13 | An intronic microRNA silences genes that are functionally antagonistic to its host gene.Nucleic Acids Res. 2008 Sep;36(16):5232-41. | ||||
| REF 14 | MiR-338-3p inhibits the growth and invasion of non-small cell lung cancer cells by targeting IRS2. Am J Cancer Res. 2017 Jan 1;7(1):53-63. | ||||
| REF 15 | MiR-338-3p inhibits epithelial-mesenchymal transition in gastric cancer cells by targeting ZEB2 and MACC1/Met/Akt signaling. Oncotarget. 2015 Jun 20;6(17):15222-34. | ||||
| REF 16 | miR-338-3p suppresses neuroblastoma proliferation, invasion and migration through targeting PREX2a.FEBS Lett. 2013 Nov 15;587(22):3729-37. | ||||
| REF 17 | Mineralocorticoid receptor suppresses cancer progression and the Warburg effect by modulating the miR-338-3p-PKLR axis in hepatocellular carcinoma.Hepatology. 2015 Oct;62(4):1145-59. | ||||
| REF 18 | HBV preS2 promotes the expression of TAZ via miRNA-338-3p to enhance the tumorigenesis of hepatocellular carcinoma.Oncotarget. 2015 Oct 6;6(30):29048-59. | ||||
| REF 19 | MicroRNA-338-3p functions as tumor suppressor in breast cancer by targeting SOX4.Int J Oncol. 2015 Oct;47(4):1594-602. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.