miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-33a-5p | ||||
| miRNA Stemloop AC | MI0000091 | ||||
| miRNA Stemloop ID | hsa-mir-33a | ||||
| Sequence | gugcauuguaguugcauugca | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Src (SRC) | Successful Target | Target Info | [1] | |
| Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [2] | ||
| Proto-oncogene c-Ros (ROS1) | Successful Target | Target Info | [3] | ||
| ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [4] | ||
| Protein kinase C beta (PRKCB) | Clinical trial Target | Target Info | [5] | ||
| Serine/threonine-protein kinase pim-1 (PIM1) | Clinical trial Target | Target Info | [6] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [7] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [8] | ||
| Nuclear receptor coactivator 3 (NCOA3) | Literature-reported Target | Target Info | [1] | ||
| Lipopolysaccharide-associated protein 1 (HSPA8) | Literature-reported Target | Target Info | [9] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [10] | ||
| ATP-binding cassette transporter B11 (ABCB11) | Literature-reported Target | Target Info | [11] | ||
| PIM-3 protein kinase (PIM3) | Patented-recorded Target | Target Info | [7] | ||
| Fos-related antigen 1 (FOSL1) | Literature-reported Target | Target Info | [10] | ||
| Sterol regulatory element binding protein-1 (SREBF1) | Literature-reported Target | Target Info | [12] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | 5'-AMP-activated protein kinase catalytic subunit alpha-1 | Regulated Protein | [14] | ||
| Actin, cytoplasmic 1 | Regulated Protein | [15] | |||
| Carnitine O-palmitoyltransferase 1, liver isoform | Regulated Protein | [14] | |||
| Cyclin-dependent kinase 16 | Regulated Protein | [16] | |||
| Disintegrin and metalloproteinase domain-containing protein 9 | Regulated Protein | [3] | |||
| DNA-binding protein SATB2 | Regulated Protein | [18] | |||
| High affinity cAMP-specific and IBMX-insensitive 3',5'-cyclic phosphodiesterase 8A | Regulated Protein | [19] | |||
| Homeobox protein engrailed-2 | Regulated Protein | [20] | |||
| Insulin receptor substrate 2 | Regulated Protein | [1] | |||
| NPC intracellular cholesterol transporter 1 | Regulated Protein | [22] | |||
| NPC intracellular cholesterol transporter 1 | Regulated Protein | [1] | |||
| Nuclear transcription factor Y subunit gamma | Regulated Protein | [1] | |||
| Oxysterol-binding protein-related protein 6 | Regulated Protein | [23] | |||
| Parathyroid hormone-related protein | Regulated Protein | [24] | |||
| Peroxisomal carnitine O-octanoyltransferase | Regulated Protein | [1] | |||
| Trifunctional enzyme subunit beta, mitochondrial | Regulated Protein | [14] | |||
| Twist-related protein 1 | Regulated Protein | [25] | |||
| UV radiation resistance-associated gene protein | Regulated Protein | [19] | |||
| References | |||||
| REF 1 | A regulatory role for microRNA 33* in controlling lipid metabolism gene expression. Mol Cell Biol. 2013 Jun;33(11):2339-52. | ||||
| REF 2 | Profibrotic effect of miR-33a with Akt activation in hepatic stellate cells. Cell Signal. 2014 Jan;26(1):141-8. | ||||
| REF 3 | MiR-33a suppresses breast cancer cell proliferation and metastasis by targeting ADAM9 and ROS1. Protein Cell. 2015 Dec;6(12):881-9. | ||||
| REF 4 | MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1566-9. | ||||
| REF 5 | GABAergic mechanisms regulated by miR-33 encode state-dependent fear. Nat Neurosci. 2015 Sep;18(9):1265-71. | ||||
| REF 6 | The proto-oncogene Pim-1 is a target of miR-33a. Oncogene. 2012 Feb 16;31(7):918-28. | ||||
| REF 7 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 8 | Effect of miR-335 upregulation on the apoptosis and invasion of lung cancer cell A549 and H1299. Tumour Biol. 2013 Oct;34(5):3101-9. | ||||
| REF 9 | Downregulation of miR-33a-5p in Hepatocellular Carcinoma: A Possible Mechanism for Chemotherapy Resistance. Med Sci Monit. 2017 Mar 14;23:1295-1304. | ||||
| REF 10 | XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057. | ||||
| REF 11 | miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity. EMBO Mol Med. 2012 Sep;4(9):882-95. | ||||
| REF 12 | MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice. Nat Commun. 2013;4:2883. | ||||
| REF 13 | MicroRNA-33a mediates the regulation of high mobility group AT-hook 2 gene (HMGA2) by thyroid transcription factor 1 (TTF-1/NKX2-1). J Biol Chem. 2013 Jun 7;288(23):16348-60. | ||||
| REF 14 | TXNIP regulates myocardial fatty acid oxidation via miR-33a signaling.Am J Physiol Heart Circ Physiol. 2016 Jul 1;311(1):H64-75. | ||||
| REF 15 | MicroRNA-33a inhibits lung cancer cell proliferation and invasion by regulating the expression of -catenin.Mol Med Rep. 2015 May;11(5):3647-51. | ||||
| REF 16 | miR-33a is downregulated in melanoma cells and modulates cell proliferation by targeting PCTAIRE1. Oncol Lett. 2016 Apr;11(4):2741-2746. | ||||
| REF 17 | MiR-33a suppresses breast cancer cell proliferation and metastasis by targeting ADAM9 and ROS1. Protein Cell. 2015 Dec;6(12):881-9. | ||||
| REF 18 | miR-33a-5p modulates TNF--inhibited osteogenic differentiation by targeting SATB2 expression in hBMSCs.FEBS Lett. 2016 Feb;590(3):396-407. | ||||
| REF 19 | miR-33a promotes glioma-initiating cell self-renewal via PKA and NOTCH pathways.J Clin Invest. 2014 Oct;124(10):4489-502. | ||||
| REF 20 | Networks analysis of genes and microRNAs in human Wilms' tumors. Oncol Lett. 2016 Nov;12(5):3579-3585. | ||||
| REF 21 | A regulatory role for microRNA 33* in controlling lipid metabolism gene expression. Mol Cell Biol. 2013 Jun;33(11):2339-52. | ||||
| REF 22 | MiR-33 contributes to the regulation of cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1570-3. | ||||
| REF 23 | miRNA Targeting of Oxysterol-Binding Protein-Like 6 Regulates Cholesterol Trafficking and Efflux.Arterioscler Thromb Vasc Biol. 2016 May;36(5):942-951. | ||||
| REF 24 | Drosophila miR-932 modulates hedgehog signaling by targeting its co-receptor Brother of ihog.Dev Biol. 2013 May 1;377(1):166-76. | ||||
| REF 25 | miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down-regulating TWIST.J Exp Clin Cancer Res. 2014 Jan 27;33:12. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.