miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-33b-5p | ||||
| miRNA Stemloop AC | MI0003646 | ||||
| miRNA Stemloop ID | hsa-mir-33b | ||||
| Sequence | gugcauugcuguugcauugc | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Src (SRC) | Successful Target | Target Info | [1] | |
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [3] | ||
| Serine/threonine-protein kinase pim-1 (PIM1) | Clinical trial Target | Target Info | [4] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [5] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [6] | ||
| Nuclear receptor ROR-alpha (RORA) | Preclinical Target | Target Info | [1] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [1] | ||
| Glucose-6-phosphatase (G6PC) | Clinical trial Target | Target Info | [1] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Phosphoenolpyruvate carboxykinase, cytosolic [GTP] | Regulated Protein | [1] | ||
| Twist-related protein 1 | Regulated Protein | [7] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902. | ||||
| REF 2 | Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266. | ||||
| REF 3 | MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1566-9. | ||||
| REF 4 | Investigational agent MLN9708/2238 targets tumor-suppressor miR33b in MM cells.Blood.2012 Nov 8;120(19):3958-67. | ||||
| REF 5 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
| REF 6 | A statin-regulated microRNA represses human c-Myc expression and function. EMBO Mol Med. 2012 Sep;4(9):896-909. | ||||
| REF 7 | Cordycepin (3'-deoxyadenosine) suppressed HMGA2, Twist1 and ZEB1-dependent melanoma invasion and metastasis by targeting miR-33b. Oncotarget. 2015;6(12):9834-53. | ||||
| REF 8 | MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902. | ||||
| REF 9 | Cordycepin (3'-deoxyadenosine) suppressed HMGA2, Twist1 and ZEB1-dependent melanoma invasion and metastasis by targeting miR-33b. Oncotarget. 2015;6(12):9834-53. | ||||
| REF 10 | MicroRNA-33b inhibits lung adenocarcinoma cell growth, invasion, and epithelial-mesenchymal transition by suppressing Wnt/-catenin/ZEB1 signaling.Int J Oncol. 2015 Dec;47(6):2141-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.