miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-346 | ||||
| miRNA Stemloop AC | MI0000826 | ||||
| miRNA Stemloop ID | hsa-mir-346 | ||||
| Sequence | ugucugcccgcaugccugccucu | ||||
| TTD Target(s) Regulated by This miRNA | Tyrosine-protein kinase BTK (ATK) | Successful Target | Target Info | [1] | |
| Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [2] | ||
| Telomerase reverse transcriptase (TERT) | Clinical trial Target | Target Info | [3] | ||
| Interleukin-18 (IL18) | Clinical trial Target | Target Info | [1] | ||
| Leukemia inhibitory factor (LIF) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Antigen peptide transporter 1 | Regulated Protein | [5] | ||
| B-cell lymphoma 6 protein | Regulated Protein | [6] | |||
| Breast cancer metastasis-suppressor 1 | Regulated Protein | [7] | |||
| EGF-containing fibulin-like extracellular matrix protein 2 | Regulated Protein | [1] | |||
| SRC kinase signaling inhibitor 1 | Regulated Protein | [9] | |||
| Zinc finger protein 823 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91. | ||||
| REF 2 | miR-346 regulates osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting the Wnt/-catenin pathway. PLoS One. 2013 Sep 4;8(9):e72266. | ||||
| REF 3 | miR-346 and miR-138 competitively regulate hTERT in GRSF1- and AGO2-dependent manners, respectively. Sci Rep. 2015 Oct 28;5:15793. | ||||
| REF 4 | Human multipotent stromal cells from bone marrow and microRNA: regulation of differentiation and leukemia inhibitory factor expression. Proc Natl Acad Sci U S A. 2008 Nov 25;105(47):18372-7. | ||||
| REF 5 | The unfolded protein response (UPR)-activated transcription factor X-box-binding protein 1 (XBP1) induces microRNA-346 expression that targets the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regulatory genes.J Biol Chem. 2011 Dec 2;286(48):41862-70. | ||||
| REF 6 | MiR-346 regulates CD4XCR5 T cells in the pathogenesis of Graves' disease.Endocrine. 2015 Aug;49(3):752-60. | ||||
| REF 7 | miR-346 promotes migration and invasion of nasopharyngeal carcinoma cells via targeting BRMS1.J Biochem Mol Toxicol. 2016 Dec;30(12):602-607. | ||||
| REF 8 | A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91. | ||||
| REF 9 | MiR-346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel.Gene. 2017 Feb 5;600:21-28. | ||||
| REF 10 | miR-346 controls release of TNF- protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization.PLoS One. 2011;6(5):e19827. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.