miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-34a-3p | ||||
| miRNA Stemloop AC | MI0000268 | ||||
| miRNA Stemloop ID | hsa-mir-34a | ||||
| Sequence | caaucagcaaguauacugcccu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [3] | ||
| Beta-catenin (CTNNB1) | Successful Target | Target Info | [4] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [5] | ||
| Phosphodiesterase 4B (PDE4B) | Clinical trial Target | Target Info | [6] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [7] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [8] | ||
| Lactate dehydrogenase A (LDHA) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | ATP synthase subunit s, mitochondrial | Regulated Protein | [10] | ||
| Axin-2 | Regulated Protein | [4] | |||
| Homeobox protein TGIF2 | Regulated Protein | [12] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [2] | |||
| Nuclear receptor corepressor 1 | Regulated Protein | [6] | |||
| Nuclear receptor corepressor 2 | Regulated Protein | [6] | |||
| Proto-oncogene FRAT1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | Expression of transforming growth factor 1 promotes cholangiocarcinoma development and progression. Cancer Lett. 2016 Sep 28;380(1):153-62. | ||||
| REF 2 | MiR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting SMAD4, FRAT1 and BCL2. Aging (Albany NY). 2017 Mar 23;9(3):932-954. | ||||
| REF 3 | Tumor suppressor miR-34a targets PD-L1 and functions as a potential immunotherapeutic target in acute myeloid leukemia. Cell Signal. 2015 Mar;27(3):443-52. | ||||
| REF 4 | MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81. | ||||
| REF 5 | Shear-sensitive microRNA-34a modulates flow-dependent regulation of endothelial inflammation. J Cell Sci. 2015 Jan 1;128(1):70-80. | ||||
| REF 6 | The microRNA network is altered in anterior cingulate cortex of patients with unipolar and bipolar depression. J Psychiatr Res. 2016 Nov;82:58-67. | ||||
| REF 7 | Down-regulation of microRNA-34a* in rheumatoid arthritis synovial fibroblasts promotes apoptosis resistance. Arthritis Rheum. 2012 Jun;64(6):1771-9. | ||||
| REF 8 | MicroRNA-34a inhibits human trophoblast cell invasion by targeting MYC. BMC Cell Biol. 2015 Sep 3;16:21. | ||||
| REF 9 | Inhibition of lactate dehydrogenase A by microRNA-34a resensitizes colon cancer cells to 5-fluorouracil. Mol Med Rep. 2015 Jan;11(1):577-82. | ||||
| REF 10 | MiR-34a is Involved in the Decrease of ATP Contents Induced by Resistin Through Target on ATP5S in HepG2 Cells.Biochem Genet. 2015 Dec;53(11-12):301-9. | ||||
| REF 11 | MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81. | ||||
| REF 12 | MiRNA-34a overexpression inhibits multiple myeloma cancer stem cell growth in mice by suppressing TGIF2. Am J Transl Res. 2016 Dec 15;8(12):5433-5443. | ||||
| REF 13 | MiR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting SMAD4, FRAT1 and BCL2. Aging (Albany NY). 2017 Mar 23;9(3):932-954. | ||||
| REF 14 | The microRNA network is altered in anterior cingulate cortex of patients with unipolar and bipolar depression. J Psychiatr Res. 2016 Nov;82:58-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.