miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-34b-3p | ||||
| miRNA Stemloop AC | MI0000742 | ||||
| miRNA Stemloop ID | hsa-mir-34b | ||||
| Sequence | caaucacuaacuccacugccau | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [3] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [5] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [6] | ||
| Thromboxane-A synthase (TBXAS1) | Clinical trial Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [8] | ||
| Synuclein alpha (SNCA) | Clinical trial Target | Target Info | [9] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [10] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [2] | ||
| Tyrosine-protein kinase ZAP-70 (ZAP-70) | Patented-recorded Target | Target Info | [11] | ||
| PAK-1 protein kinase (PAK1) | Literature-reported Target | Target Info | [3] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [12] | ||
| IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [6] | ||
| N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [13] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | Homeobox protein NANOG | Regulated Protein | [13] | ||
| Immunoglobulin-binding protein 1 | Regulated Protein | [15] | |||
| Interleukin-6 receptor subunit alpha | Regulated Protein | [16] | |||
| N-acetylgalactosaminyltransferase 7 | Regulated Protein | [17] | |||
| Protein jagged-1 | Regulated Protein | [8] | |||
| Transcriptional repressor protein YY1 | Regulated Protein | [19] | |||
| Ubiquitin carboxyl-terminal hydrolase 22 | Regulated Protein | [20] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [21] | |||
| References | |||||
| REF 1 | Methylation-associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect. Carcinogenesis. 2010 Dec;31(12):2066-73. | ||||
| REF 2 | A microRNA DNA methylation signature for human cancer metastasis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13556-61. | ||||
| REF 3 | Sirolimus induces apoptosis and reverses multidrug resistance in human osteosarcoma cells in vitro via increasing microRNA-34b expression. Acta Pharmacol Sin. 2016 Apr;37(4):519-29. | ||||
| REF 4 | p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr Biol. 2007 Aug 7;17(15):1298-307. | ||||
| REF 5 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 6 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
| REF 7 | Thromboxane A2 receptor promotes tumor growth through an autoregulatory feedback pathway. J Mol Cell Biol. 2013 Dec;5(6):380-90. | ||||
| REF 8 | miRNA-34b as a tumor suppressor in estrogen-dependent growth of breast cancer cells. Breast Cancer Res. 2011;13(6):R116. | ||||
| REF 9 | Inhibition of miR-34b and miR-34c enhances -synuclein expression in Parkinson's disease. FEBS Lett. 2015 Jan 30;589(3):319-25. | ||||
| REF 10 | Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266. | ||||
| REF 11 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
| REF 12 | miR-34b targets cyclic AMP-responsive element binding protein in acute myeloid leukemia. Cancer Res. 2009 Mar 15;69(6):2471-8. | ||||
| REF 13 | miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60. | ||||
| REF 14 | miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60. | ||||
| REF 15 | miR-3941: A novel microRNA that controls IGBP1 expression and is associated with malignant progression of lung adenocarcinoma.Cancer Sci. 2017 Mar;108(3):536-542. | ||||
| REF 16 | IL-6R/STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis.J Clin Invest. 2014 Apr;124(4):1853-67. | ||||
| REF 17 | MicroRNA 4a/c function as tumor suppressors in Hep laryngeal carcinoma cells and may reduce GALNT7 expression.Mol Med Rep. 2014 Apr;9(4):1293-8. | ||||
| REF 18 | miRNA-34b as a tumor suppressor in estrogen-dependent growth of breast cancer cells. Breast Cancer Res. 2011;13(6):R116. | ||||
| REF 19 | Yin Yang 1 is a target of microRNA-34 family and contributes to gastric carcinogenesis.Oncotarget. 2014 Jul 15;5(13):5002-16. | ||||
| REF 20 | miR-34b inhibits nasopharyngeal carcinoma cell proliferation by targeting ubiquitin-specific peptidase 22.Onco Targets Ther. 2016 Mar 16;9:1525-34. | ||||
| REF 21 | miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions.Cell Cycle. 2011 Dec 15;10(24):4256-71. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.