miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-34b-5p | ||||
| miRNA Stemloop AC | MI0000742 | ||||
| miRNA Stemloop ID | hsa-mir-34b | ||||
| Sequence | uaggcagugucauuagcugauug | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [3] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [4] | ||
| Beta-catenin (CTNNB1) | Successful Target | Target Info | [5] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [6] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [7] | ||
| Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [8] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [9] | ||
| N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [10] | ||
| G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Axin-2 | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9. | ||||
| REF 2 | Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266. | ||||
| REF 3 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 4 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 5 | MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81. | ||||
| REF 6 | Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86. | ||||
| REF 7 | Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79. | ||||
| REF 8 | In silico and in vitro identification of microRNAs that regulate hepatic nuclear factor 4 expression. Drug Metab Dispos. 2012 Apr;40(4):726-33. | ||||
| REF 9 | miR-34b targets cyclic AMP-responsive element binding protein in acute myeloid leukemia. Cancer Res. 2009 Mar 15;69(6):2471-8. | ||||
| REF 10 | A combined gene expression and functional study reveals the crosstalk between N-Myc and differentiation-inducing microRNAs in neuroblastoma cells. Oncotarget. 2016 Nov 29;7(48):79372-79387. | ||||
| REF 11 | MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.