miRNA General Information
miRNA Mature ID hsa-miR-3622b-5p
miRNA Stemloop AC MI0016014
miRNA Stemloop ID hsa-mir-3622b
Sequence aggcaugggaggucagguga
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [2]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [1]
References
REF 1 Novel tumor suppressor microRNA at frequently deleted chromosomal region 8p21 regulates epidermal growth factor receptor in prostate cancer. Oncotarget. 2016 Oct 25;7(43):70388-70403.
REF 2 Tumor suppressor role of miR-3622b-5p in ERBB2-positive cancer. Oncotarget. 2017 Apr 4;8(14):23008-23019.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.