miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-373-3p | ||||
| miRNA Stemloop AC | MI0000781 | ||||
| miRNA Stemloop ID | hsa-mir-373 | ||||
| Sequence | gaagugcuucgauuuuggggugu | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| PI3-kinase alpha (PIK3CA) | Successful Target | Target Info | [2] | ||
| Janus kinase 1 (JAK-1) | Successful Target | Target Info | [3] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [4] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [1] | ||
| Dickkopf-related protein 1 (DKK1) | Clinical trial Target | Target Info | [5] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [6] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [7] | ||
| Tumor suppressor candidate 2 (TUSC2) | Clinical trial Target | Target Info | [8] | ||
| Large tumor suppressor homolog 2 (LATS2) | Literature-reported Target | Target Info | [9] | ||
| MST-1 protein kinase (STK4) | Literature-reported Target | Target Info | [8] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [10] | ||
| Cell surface protein HB15 (CD83) | Literature-reported Target | Target Info | [8] | ||
| Vitamin D3 up-regulated protein 1 (VDUP1) | Literature-reported Target | Target Info | [11] | ||
| DNA repair protein complementing XP-A cells (XPA) | Literature-reported Target | Target Info | [12] | ||
| B-cell translocation gene 1 protein (BTG1) | Literature-reported Target | Target Info | [6] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | BTB/POZ domain-containing adapter for CUL3-mediated RhoA degradation protein 2 | Regulated Protein | [14] | ||
| Cold shock domain-containing protein C2 | Regulated Protein | [15] | |||
| DNA repair protein RAD52 homolog | Regulated Protein | [12] | |||
| Double-strand break repair protein MRE11 | Regulated Protein | [12] | |||
| Interferon regulatory factor 9 | Regulated Protein | [3] | |||
| Left-right determination factor 1 | Regulated Protein | [6] | |||
| Left-right determination factor 2 | Regulated Protein | [19] | |||
| Methyl-CpG-binding domain protein 2 | Regulated Protein | [20] | |||
| Nuclear factor 1 B-type | Regulated Protein | [21] | |||
| Rab GTPase-binding effector protein 1 | Regulated Protein | [22] | |||
| Ras association domain-containing protein 1 | Regulated Protein | [20] | |||
| UV excision repair protein RAD23 homolog B | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76. | ||||
| REF 2 | Reactivation of epigenetically silenced miR-512 and miR-373 sensitizes lung cancer cells to cisplatin and restricts tumor growth. Cell Death Differ. 2015 Aug;22(8):1328-40. | ||||
| REF 3 | Hepatitis C virus-mediated enhancement of microRNA miR-373 impairs the JAK/STAT signaling pathway. J Virol. 2015 Mar;89(6):3356-65. | ||||
| REF 4 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 5 | miR-373-3p Targets DKK1 to Promote EMT-Induced Metastasis via the Wnt/-Catenin Pathway in Tongue Squamous Cell Carcinoma. Biomed Res Int. 2017;2017:6010926. | ||||
| REF 6 | -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78. | ||||
| REF 7 | The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10. | ||||
| REF 8 | Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73. | ||||
| REF 9 | A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 2006 Mar 24;124(6):1169-81. | ||||
| REF 10 | Stem cell-like micro-RNA signature driven by Myc in aggressive liver cancer. Proc Natl Acad Sci U S A. 2010 Nov 23;107(47):20471-6. | ||||
| REF 11 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 12 | MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009 Feb 1;69(3):1221-9. | ||||
| REF 13 | MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80. | ||||
| REF 14 | MicroRNA-373 is upregulated and targets TNFAIP1 in human gastric cancer, contributing to tumorigenesis. Oncol Lett. 2013 Nov;6(5):1427-1434. | ||||
| REF 15 | MicroRNA-373 induces expression of genes with complementary promoter sequences.Proc Natl Acad Sci U S A. 2008 Feb 5;105(5):1608-13. | ||||
| REF 16 | MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009 Feb 1;69(3):1221-9. | ||||
| REF 17 | Hepatitis C virus-mediated enhancement of microRNA miR-373 impairs the JAK/STAT signaling pathway. J Virol. 2015 Mar;89(6):3356-65. | ||||
| REF 18 | -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78. | ||||
| REF 19 | miR-373 is regulated by TGF signaling and promotes mesendoderm differentiation in human Embryonic Stem Cells.Dev Biol. 2014 Jul 1;391(1):81-8. | ||||
| REF 20 | miR-373 negatively regulates methyl-CpG-binding domain protein 2 (MBD2) in hilar cholangiocarcinoma.Dig Dis Sci. 2011 Jun;56(6):1693-701. | ||||
| REF 21 | MicroRNAs-372/373 promote the expression of hepatitis B virus through the targeting of nuclear factor I/B.Hepatology. 2011 Sep 2;54(3):808-19. | ||||
| REF 22 | Global identification of miR-373-regulated genes in breast cancer by quantitative proteomics. Proteomics. 2011 Mar;11(5):912-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.