miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-374a-5p | ||||
| miRNA Stemloop AC | MI0000782 | ||||
| miRNA Stemloop ID | hsa-mir-374a | ||||
| Sequence | uuauaauacaaccugauaagug | ||||
| TTD Target(s) Regulated by This miRNA | ATM serine/threonine kinase (ATM) | Clinical trial Target | Target Info | [1] | |
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [2] | ||
| Lactate dehydrogenase A (LDHA) | Literature-reported Target | Target Info | [3] | ||
| CCAAT/enhancer binding protein beta (CEBPB) | Literature-reported Target | Target Info | [4] | ||
| Wnt-5a protein (WNT5A) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Growth arrest and DNA damage-inducible protein GADD45 alpha | Regulated Protein | [6] | ||
| SRC kinase signaling inhibitor 1 | Regulated Protein | [7] | |||
| Wnt inhibitory factor 1 | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase. Mol Oncol. 2014 Feb;8(1):83-92. | ||||
| REF 2 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 3 | Lactate dehydrogenase A negatively regulated by miRNAs promotes aerobic glycolysis and is increased in colorectal cancer. Oncotarget. 2015 Aug 14;6(23):19456-68. | ||||
| REF 4 | miRNA-374 regulates dexamethasone-induced differentiation of primary cultures of porcine adipocytes. Horm Metab Res. 2013 Jul;45(7):518-25. | ||||
| REF 5 | Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014 May 15;5:e1227. | ||||
| REF 6 | Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30. | ||||
| REF 7 | miR-374a promotes cell proliferation, migration and invasion by targeting SRCIN1 in gastric cancer.FEBS Lett. 2015 Jan 30;589(3):407-13. | ||||
| REF 8 | MicroRNA-374a activates Wnt/-catenin signaling to promote breast cancer metastasis.J Clin Invest. 2013 Feb;123(2):566-79. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.