miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-378a-5p | ||||
| miRNA Stemloop AC | MI0000786 | ||||
| miRNA Stemloop ID | hsa-mir-378a | ||||
| Sequence | cuccugacuccagguccugugu | ||||
| miRNA General Information | |||||
| miRNA Mature ID | hsa-miR-378a-5p | ||||
| miRNA Stemloop AC | MI0000786 | ||||
| miRNA Stemloop ID | hsa-mir-378 | ||||
| Sequence | cuccugacuccagguccugugu | ||||
| TTD Target(s) Regulated by This miRNA | Tumor suppressor candidate 2 (TUSC2) | Clinical trial Target | Target Info | [1] | |
| Nodal homolog (NODAL) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Suppressor of fused homolog | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73. | ||||
| REF 2 | MicroRNA-378a-5p promotes trophoblast cell survival, migration and invasion by targeting Nodal. J Cell Sci. 2012 Jul 1;125(Pt 13):3124-32. | ||||
| REF 3 | MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A. 2007 Dec 18;104(51):20350-5. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.