miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-381-3p | ||||
| miRNA Stemloop AC | MI0000789 | ||||
| miRNA Stemloop ID | hsa-mir-381 | ||||
| Sequence | uauacaagggcaagcucucugu | ||||
| TTD Target(s) Regulated by This miRNA | Calcium-dependent chloride channel anoctamin (ANO) | Successful Target | Target Info | [1] | |
| Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [2] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [3] | ||
| Gap junction alpha-1 protein (GJA1) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | NF-kappa-B inhibitor alpha | Regulated Protein | [5] | ||
| P2X purinoceptor 5 | Regulated Protein | [6] | |||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 | Regulated Protein | [7] | |||
| T-cell surface glycoprotein CD1c | Regulated Protein | [8] | |||
| TBC1 domain family member 9 | Regulated Protein | [9] | |||
| Twist-related protein 1 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | MicroRNA-381 inhibits the metastasis of gastric cancer by targeting TMEM16A expression. J Exp Clin Cancer Res. 2017 Feb 13;36(1):29. | ||||
| REF 2 | MicroRNA-381 Regulates Chondrocyte Hypertrophy by Inhibiting Histone Deacetylase 4 Expression. Int J Mol Sci. 2016 Aug 23;17(9). pii: E1377. | ||||
| REF 3 | Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8. | ||||
| REF 4 | Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells. Biosci Rep. 2015 Aug 17;35(5). pii: e00251. | ||||
| REF 5 | Increased miR-381a-3p Contributes to Osteoarthritis by Targeting IkB.Ann Clin Lab Sci. 2016 May;46(3):247-53. | ||||
| REF 6 | MicroRNA-381 suppresses cell growth and invasion by targeting the liver receptor homolog-1 in hepatocellular carcinoma.Oncol Rep. 2016 Mar;35(3):1831-40. | ||||
| REF 7 | SMARCB1 expression in epithelioid sarcoma is regulated by miR-206, miR-381, and miR-671-5p on Both mRNA and protein levels.Genes Chromosomes Cancer. 2014 Feb;53(2):168-76. | ||||
| REF 8 | MiR-381-3p Regulates the Antigen-Presenting Capability of Dendritic Cells and Represses Antituberculosis Cellular Immune Responses by Targeting CD1c.J Immunol. 2016 Jul 15;197(2):580-9. | ||||
| REF 9 | Changes in the expression of miR-381 and miR-495 are inversely associated with the expression of the MDR1 gene and development of multi-drug resistance.PLoS One. 2013 Nov 26;8(11):e82062. | ||||
| REF 10 | MiR-381 functions as a tumor suppressor in colorectal cancer by targeting Twist1.Onco Targets Ther. 2016 Mar 7;9:1231-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.