miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-3940-5p | ||||
| miRNA Stemloop AC | MI0016597 | ||||
| miRNA Stemloop ID | hsa-mir-3940 | ||||
| Sequence | guggguuggggcgggcucug | ||||
| TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Ubiquitin carboxyl-terminal hydrolase 28 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 2 | miR-3940-5p Functions as a Tumor Suppressor in Non-Small Cell Lung Cancer Cells by Targeting Cyclin D1 and Ubiquitin Specific Peptidase-28. Transl Oncol. 2017 Feb;10(1):80-89. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.