miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-421 | ||||
| miRNA Stemloop AC | MI0003685 | ||||
| miRNA Stemloop ID | hsa-mir-421 | ||||
| Sequence | aucaacagacauuaauugggcgc | ||||
| TTD Target(s) Regulated by This miRNA | ATM serine/threonine kinase (ATM) | Clinical trial Target | Target Info | [1] | |
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [2] | ||
| Chromobox protein homolog 7 (CBX7) | Literature-reported Target | Target Info | [3] | ||
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Forkhead box protein O4 | Regulated Protein | [5] | ||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [6] | |||
| NAD-dependent protein deacetylase sirtuin-3, mitochondrial | Regulated Protein | [7] | |||
| RNA binding motif protein, X-linked-like-1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | ATM is down-regulated by N-Myc-regulated microRNA-421. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1506-11. | ||||
| REF 2 | MiR-421 regulates apoptosis of BGC-823 gastric cancer cells by targeting caspase-3. Asian Pac J Cancer Prev. 2014;15(13):5463-8. | ||||
| REF 3 | Increased expression of miR-421 in human gastric carcinoma and its clinical association. J Gastroenterol. 2010;45(1):17-23. | ||||
| REF 4 | MicroRNA-421 regulated by HIF-1 promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget. 2016 Apr 26;7(17):24466-82. | ||||
| REF 5 | miR-421 induces cell proliferation and apoptosis resistance in human nasopharyngeal carcinoma via downregulation of FOXO4.Biochem Biophys Res Commun. 2013 Jun 14;435(4):745-50. | ||||
| REF 6 | MicroRNA 421 suppresses DPC4/Smad4 in pancreatic cancer.Biochem Biophys Res Commun. 2011 Mar 25;406(4):552-7. | ||||
| REF 7 | MicroRNA-421 induces hepatic mitochondrial dysfunction in non-alcoholic fatty liver disease mice by inhibiting sirtuin 3.Biochem Biophys Res Commun. 2016 May 20;474(1):57-63. | ||||
| REF 8 | Increased expression of miR-421 in human gastric carcinoma and its clinical association. J Gastroenterol. 2010;45(1):17-23. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.