miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-429
miRNA Stemloop AC MI0001641
miRNA Stemloop ID hsa-mir-429
Sequence uaauacugucugguaaaaccgu
TTD Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [1]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [2]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [3]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [3]
X-linked inhibitor of apoptosis protein (XIAP) Clinical trial Target Target Info [1]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [4]
Interleukin-4 (IL4) Clinical trial Target Target Info [5]
Fascin (FSCN1) Clinical trial Target Target Info [6]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [7]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [8]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [9]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [10]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [11]
Protein(s) Regulated by This miRNA Arginine-glutamic acid dipeptide repeats protein Regulated Protein
RERE_HUMAN
[12]
Crk-like protein Regulated Protein
CRKL_HUMAN
[13]
Engulfment and cell motility protein 2 Regulated Protein
ELMO2_HUMAN
[14]
Erbin Regulated Protein
ERBIN_HUMAN
[14]
Histone-binding protein RBBP4 Regulated Protein
RBBP4_HUMAN
[15]
Homeobox protein Hox-B5 Regulated Protein
HXB5_HUMAN
[14]
Kelch-like protein 20 Regulated Protein
KLH20_HUMAN
[14]
Krueppel-like factor 11 Regulated Protein
KLF11_HUMAN
[14]
Metalloproteinase inhibitor 2 Regulated Protein
TIMP2_HUMAN
[8]
One cut domain family member 2 Regulated Protein
ONEC2_HUMAN
[17]
Osteoclast-stimulating factor 1 Regulated Protein
OSTF1_HUMAN
[18]
Protein VAC14 homolog Regulated Protein
VAC14_HUMAN
[14]
Ras and Rab interactor 2 Regulated Protein
RIN2_HUMAN
[14]
Ras association domain-containing protein 2 Regulated Protein
RASF2_HUMAN
[14]
Ras association domain-containing protein 8 Regulated Protein
RASF8_HUMAN
[8]
Receptor-type tyrosine-protein phosphatase delta Regulated Protein
PTPRD_HUMAN
[14]
Rho GTPase-activating protein 7 Regulated Protein
RHG07_HUMAN
[19]
Septin-7 Regulated Protein
SEPT7_HUMAN
[14]
SHC-transforming protein 1 Regulated Protein
SHC1_HUMAN
[14]
Transcription factor 7-like 1 Regulated Protein
TF7L1_HUMAN
[14]
Ubiquitin carboxyl-terminal hydrolase BAP1 Regulated Protein
BAP1_HUMAN
[14]
WD repeat-containing protein 37 Regulated Protein
WDR37_HUMAN
[14]
Wiskott-Aldrich syndrome protein family member 3 Regulated Protein
WASF3_HUMAN
[20]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[11]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[22]
Zinc finger protein ZFPM2 Regulated Protein
FOG2_HUMAN
[14]
References
REF 1 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31.
REF 2 Tumor suppressive microRNA 29 regulates cellular function by targeting VEGF in clear cell renal cell carcinoma. Mol Med Rep. 2016 Feb;13(2):1361-6.
REF 3 DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression. Cancer Lett. 2015 Apr 10;359(2):198-205.
REF 4 The hypoxia-inducible miR-429 regulates hypoxia-inducible factor-1 expression in human endothelial cells through a negative feedback loop. FASEB J. 2015 Apr;29(4):1467-79.
REF 5 IL-4, a direct target of miR-340/429, is involved in radiation-induced aggressive tumor behavior in human carcinoma cells. Oncotarget. 2016 Dec 27;7(52):86836-86856.
REF 6 miR-429 functions as a tumor suppressor by targeting FSCN1 in gastric cancer cells. Onco Targets Ther. 2016 Mar 3;9:1123-33.
REF 7 Tumor-suppressing effects of microRNA-429 in human renal cell carcinoma via the downregulation of Sp1. Oncol Lett. 2016 Oct;12(4):2906-2911.
REF 8 MicroRNA-429 induces tumorigenesis of human non-small cell lung cancer cells and targets multiple tumor suppressor genes. Biochem Biophys Res Commun. 2014 Jul 18;450(1):154-9.
REF 9 miR-429 modulates the expression of c-myc in human gastric carcinoma cells. Eur J Cancer. 2011 Nov;47(17):2552-9.
REF 10 MiR-429 is an independent prognostic factor in colorectal cancer and exerts its anti-apoptotic function by targeting SOX2. Cancer Lett. 2013 Feb 1;329(1):84-90.
REF 11 The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.
REF 12 The conserved microRNA miR-8 tunes atrophin levels to prevent neurodegeneration in Drosophila.Cell. 2007 Oct 5;131(1):136-45.
REF 13 CRKL oncogene is downregulated by p53 through miR-200s.Cancer Sci. 2015 Aug;106(8):1033-40.
REF 14 Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K.Cell. 2009 Dec 11;139(6):1096-108.
REF 15 Epigenetic modification of MiR-429 promotes liver tumour-initiating cell properties by targeting Rb binding protein 4.Gut. 2015 Jan;64(1):156-67.
REF 16 MicroRNA-429 induces tumorigenesis of human non-small cell lung cancer cells and targets multiple tumor suppressor genes. Biochem Biophys Res Commun. 2014 Jul 18;450(1):154-9.
REF 17 MiR-429 inhibits cells growth and invasion and regulates EMT-related marker genes by targeting Onecut2 in colorectal carcinoma.Mol Cell Biochem. 2014 May;390(1-2):19-30.
REF 18 miR-429 regulation of osmotic stress transcription factor 1 (OSTF1) in tilapia during osmotic stress.Biochem Biophys Res Commun. 2012 Sep 28;426(3):294-8.
REF 19 miR-429 promotes the proliferation of non-small cell lung cancer cells via targeting DLC-1. Oncol Lett. 2016 Sep;12(3):2163-2168.
REF 20 The miR200 family of microRNAs regulates WAVE3-dependent cancer cell invasion.J Biol Chem. 2009 Nov 27;284(48):33019-29.
REF 21 The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.
REF 22 Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: evidence supporting a mesothelial-to-epithelial transition. Gynecol Oncol. 2010 Jan;116(1):117-25.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.