miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-448 | ||||
| miRNA Stemloop AC | MI0001637 | ||||
| miRNA Stemloop ID | hsa-mir-448 | ||||
| Sequence | uugcauauguaggaugucccau | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [2] | ||
| Mammalian disintegrin-metalloprotease (ADAM10) | Clinical trial Target | Target Info | [3] | ||
| Stromal cell-derived factor 1 (CXCL12) | Clinical trial Target | Target Info | [4] | ||
| IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | DNA-binding protein SATB1 | Regulated Protein | [5] | ||
| Lysine-specific demethylase 2B | Regulated Protein | [6] | |||
| Metallophosphoesterase MPPED2 | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | miR-448 suppresses proliferation and invasion by regulating IGF1R in colorectal cancer cells. Am J Transl Res. 2016 Jul 15;8(7):3013-22. | ||||
| REF 2 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
| REF 3 | miR-448 suppressed gastric cancer proliferation and invasion by regulating ADAM10. Tumour Biol. 2016 Aug;37(8):10545-51. | ||||
| REF 4 | miR-448 negatively regulates ovarian cancer cell growth and metastasis by targeting CXCL12. Clin Transl Oncol. 2015 Nov;17(11):903-9. | ||||
| REF 5 | Involvement of NF-B/miR-448 regulatory feedback loop in chemotherapy-induced epithelial-mesenchymal transition of breast cancer cells.Cell Death Differ. 2011 Jan;18(1):16-25. | ||||
| REF 6 | MiR-448 promotes glycolytic metabolism of gastric cancer by downregulating KDM2B.Oncotarget. 2016 Apr 19;7(16):22092-102. | ||||
| REF 7 | miR-448 downregulates MPPED2 to promote cancer proliferation and inhibit apoptosis in oral squamous cell carcinoma. Exp Ther Med. 2016 Oct;12(4):2747-2752. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.