miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-449b-5p | ||||
| miRNA Stemloop AC | MI0003673 | ||||
| miRNA Stemloop ID | hsa-mir-449b | ||||
| Sequence | aggcaguguauuguuagcuggc | ||||
| TTD Target(s) Regulated by This miRNA | Histone deacetylase 1 (HDAC1) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [2] | ||
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [1] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [2] | ||
| Geminin (GMNN) | Literature-reported Target | Target Info | [1] | ||
| N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [3] | ||
| G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [1] | ||
| References | |||||
| REF 1 | miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29. | ||||
| REF 2 | miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93. | ||||
| REF 3 | A combined gene expression and functional study reveals the crosstalk between N-Myc and differentiation-inducing microRNAs in neuroblastoma cells. Oncotarget. 2016 Nov 29;7(48):79372-79387. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.