miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-449c-5p | ||||
| miRNA Stemloop AC | MI0003823 | ||||
| miRNA Stemloop ID | hsa-mir-449c | ||||
| Sequence | uaggcaguguauugcuagcggcugu | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Met (MET) | Successful Target | Target Info | [1] | |
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | MiR-449c inhibits gastric carcinoma growth. Life Sci. 2015 Sep 15;137:14-9. | ||||
| REF 2 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.