miRNA General Information
miRNA Mature ID	hsa-miR-450a-1-3p
miRNA Stemloop AC	MI0001652
miRNA Stemloop ID	hsa-mir-450a-1
Sequence	auugggaacauuuugcauguau
TTD Target(s) Regulated by This miRNA	BUB1 mitotic checkpoint serine/threonine kinase (BUB1)	Patented-recorded Target	Target Info	[1]
References
REF 1	MicroRNA-450a-3p represses cell proliferation and regulates embryo development by regulating Bub1 expression in mouse. PLoS One. 2012;7(10):e47914.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.