miRNA General Information
miRNA Mature ID hsa-miR-451a
miRNA Stemloop AC MI0001729
miRNA Stemloop ID hsa-mir-451a
Sequence aaaccguuaccauuacugaguu
miRNA General Information
miRNA Mature ID hsa-miR-451a
miRNA Stemloop AC MI0001729
miRNA Stemloop ID hsa-mir-451
Sequence aaaccguuaccauuacugaguu
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Multidrug resistance protein 1 (ABCB1) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [1]
Interleukin-6 (IL6) Successful Target Target Info [3]
Oxytocin receptor (OTR) Successful Target Target Info [4]
Matrix metalloproteinase-9 (MMP-9) Clinical trial Target Target Info [1]
RAC-alpha serine/threonine-protein kinase (AKT1) Clinical trial Target Target Info [1]
Extracellular signal-regulated kinase 2 (ERK2) Clinical trial Target Target Info [5]
Inhibitor of nuclear factor kappa-B kinase beta (IKKB) Clinical trial Target Target Info [6]
Macrophage migration inhibitory factor (MIF) Clinical trial Target Target Info [7]
Mammalian disintegrin-metalloprotease (ADAM10) Clinical trial Target Target Info [8]
MAPK/ERK kinase kinase 1 (MAP3K1) Clinical trial Target Target Info [9]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [10]
Protein(s) Regulated by This miRNA Calcium-binding protein 39 Regulated Protein [11]
Copine-3 Regulated Protein [12]
Cyclin-dependent kinase 4 inhibitor D Regulated Protein [9]
Discoidin, CUB and LCCL domain-containing protein 2 Regulated Protein [14]
Hamartin Regulated Protein [15]
Interleukin-6 receptor subunit alpha Regulated Protein [16]
Polycystin-1 Regulated Protein [17]
Protein odd-skipped-related 1 Regulated Protein [17]
Ras-related protein Rab-14 Regulated Protein [18]
Ras-related protein Rab-5A Regulated Protein [12]
Secreted frizzled-related protein 3 Regulated Protein [17]
Transmembrane emp24 domain-containing protein 7 Regulated Protein [1]
Tyrosine-protein kinase transmembrane receptor ROR2 Regulated Protein [17]
References
REF 1 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 2 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9.
REF 3 miR-451 acts as a suppressor of angiogenesis in hepatocellular carcinoma by targeting the IL-6R-STAT3 pathway. Oncol Rep. 2016 Sep;36(3):1385-92.
REF 4 Hypomethylation of miR-142 promoter and upregulation of microRNAs that target the oxytocin receptor gene in the autism prefrontal cortex. Mol Autism. 2015 Aug 14;6:46.
REF 5 High-Throughput Screening Identifies miR-451 as a Pleiotropic Modulator That Suppresses Gastric Cancer Metastasis. SLAS Technol. 2017 Apr;22(2):136-143.
REF 6 miR-451 inhibits cell proliferation in human hepatocellular carcinoma through direct suppression of IKK-. Carcinogenesis. 2013 Nov;34(11):2443-51.
REF 7 microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin Cancer Res. 2009 Apr 1;15(7):2281-90.
REF 8 Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. Oncogene. 2015 Jun;34(25):3283-95.
REF 9 MiR-451 inhibits proliferation of esophageal carcinoma cell line EC9706 by targeting CDKN2D and MAP3K1. World J Gastroenterol. 2015 May 21;21(19):5867-76.
REF 10 MicroRNA-451 induces epithelial-mesenchymal transition in docetaxel-resistant lung adenocarcinoma cells by targeting proto-oncogene c-Myc. Eur J Cancer. 2014 Nov;50(17):3050-67.
REF 11 MicroRNA-451 regulates LKB1/AMPK signaling and allows adaptation to metabolic stress in glioma cells.Mol Cell. 2010 Mar 12;37(5):620-32.
REF 12 MicroRNA-451 down-regulates neutrophil chemotaxis via p38 MAPK.Arthritis Rheumatol. 2014 Mar;66(3):549-59.
REF 13 MiR-451 inhibits proliferation of esophageal carcinoma cell line EC9706 by targeting CDKN2D and MAP3K1. World J Gastroenterol. 2015 May 21;21(19):5867-76.
REF 14 Identification of tumour suppressive microRNA-451a in hypopharyngeal squamous cell carcinoma based on microRNA expression signature.Br J Cancer. 2014 Jul 15;111(2):386-94.
REF 15 miR-101-2, miR-125b-2 and miR-451a act as potential tumor suppressors in gastric cancer through regulation of the PI3K/AKT/mTOR pathway.Cell Oncol (Dordr). 2016 Feb;39(1):23-33.
REF 16 MicroRNA-451 suppresses tumor cell growth by down-regulating IL6R gene expression.Cancer Epidemiol. 2014 Feb;38(1):85-92.
REF 17 MicroRNA expression profiling and target genes study in congenital microtia. Int J Pediatr Otorhinolaryngol. 2013 Apr;77(4):483-7.
REF 18 MicroRNA-451 functions as a tumor suppressor in human non-small cell lung cancer by targeting ras-related protein 14 (RAB14).Oncogene. 2011 Jun 9;30(23):2644-58.
REF 19 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.